Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1125171187:

Variant ID: vg1125171187 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25171187
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:

GATAGCTTTGCTCTCTCTCTTCATTTAATATATTCCAAGTAGGAAAATATGCTGACATGGATCTCTTGTAGAGAGCTTATAGATAACTATTGTGGGTGCC[C/T]
TAAGGATATACTAGCTTGCTGATGAGGCCCTATTACTACTTTTTTTTTACAAATTAAATTTAAAGCAATTTAACTTTAATTAAAGTTTAAATAACTTATA

Reverse complement sequence

TATAAGTTATTTAAACTTTAATTAAAGTTAAATTGCTTTAAATTTAATTTGTAAAAAAAAAGTAGTAATAGGGCCTCATCAGCAAGCTAGTATATCCTTA[G/A]
GGCACCCACAATAGTTATCTATAAGCTCTCTACAAGAGATCCATGTCAGCATATTTTCCTACTTGGAATATATTAAATGAAGAGAGAGAGCAAAGCTATC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.80%	31.20%	1.80%	35.19%	NA
All Indica	2759	47.20%	9.40%	1.56%	41.86%	NA
All Japonica	1512	8.50%	66.50%	1.39%	23.61%	NA
Aus	269	17.50%	28.60%	6.32%	47.58%	NA
Indica I	595	32.90%	3.40%	2.69%	61.01%	NA
Indica II	465	43.40%	17.20%	0.86%	38.49%	NA
Indica III	913	55.60%	4.70%	1.42%	38.23%	NA
Indica Intermediate	786	50.50%	14.60%	1.27%	33.59%	NA
Temperate Japonica	767	2.50%	91.70%	0.26%	5.61%	NA
Tropical Japonica	504	15.90%	26.40%	3.37%	54.37%	NA
Japonica Intermediate	241	12.00%	70.50%	0.83%	16.60%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	28.90%	41.10%	4.44%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125171187	C -> T	LOC_Os11g41850.1	upstream_gene_variant ; 3441.0bp to feature; MODIFIER	silent_mutation	Average:44.885; most accessible tissue: Callus, score: 98.666	N	N	N	N
vg1125171187	C -> T	LOC_Os11g41860.1	upstream_gene_variant ; 532.0bp to feature; MODIFIER	silent_mutation	Average:44.885; most accessible tissue: Callus, score: 98.666	N	N	N	N
vg1125171187	C -> T	LOC_Os11g41860.2	upstream_gene_variant ; 511.0bp to feature; MODIFIER	silent_mutation	Average:44.885; most accessible tissue: Callus, score: 98.666	N	N	N	N
vg1125171187	C -> T	LOC_Os11g41870.1	downstream_gene_variant ; 3827.0bp to feature; MODIFIER	silent_mutation	Average:44.885; most accessible tissue: Callus, score: 98.666	N	N	N	N
vg1125171187	C -> T	LOC_Os11g41850-LOC_Os11g41860	intergenic_region ; MODIFIER	silent_mutation	Average:44.885; most accessible tissue: Callus, score: 98.666	N	N	N	N
vg1125171187	C -> DEL	N	N	silent_mutation	Average:44.885; most accessible tissue: Callus, score: 98.666	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125171187	2.86E-09	1.68E-08	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125171187	2.88E-08	2.69E-10	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125171187	NA	5.15E-07	mr1745	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125171187	NA	1.67E-08	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125171187	1.43E-10	3.63E-09	mr1662_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125171187	4.78E-09	1.31E-12	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125171187	NA	2.56E-06	mr1745_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251