| Variant ID: vg1125171187 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25171187 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 116. )
GATAGCTTTGCTCTCTCTCTTCATTTAATATATTCCAAGTAGGAAAATATGCTGACATGGATCTCTTGTAGAGAGCTTATAGATAACTATTGTGGGTGCC[C/T]
TAAGGATATACTAGCTTGCTGATGAGGCCCTATTACTACTTTTTTTTTACAAATTAAATTTAAAGCAATTTAACTTTAATTAAAGTTTAAATAACTTATA
TATAAGTTATTTAAACTTTAATTAAAGTTAAATTGCTTTAAATTTAATTTGTAAAAAAAAAGTAGTAATAGGGCCTCATCAGCAAGCTAGTATATCCTTA[G/A]
GGCACCCACAATAGTTATCTATAAGCTCTCTACAAGAGATCCATGTCAGCATATTTTCCTACTTGGAATATATTAAATGAAGAGAGAGAGCAAAGCTATC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.80% | 31.20% | 1.80% | 35.19% | NA |
| All Indica | 2759 | 47.20% | 9.40% | 1.56% | 41.86% | NA |
| All Japonica | 1512 | 8.50% | 66.50% | 1.39% | 23.61% | NA |
| Aus | 269 | 17.50% | 28.60% | 6.32% | 47.58% | NA |
| Indica I | 595 | 32.90% | 3.40% | 2.69% | 61.01% | NA |
| Indica II | 465 | 43.40% | 17.20% | 0.86% | 38.49% | NA |
| Indica III | 913 | 55.60% | 4.70% | 1.42% | 38.23% | NA |
| Indica Intermediate | 786 | 50.50% | 14.60% | 1.27% | 33.59% | NA |
| Temperate Japonica | 767 | 2.50% | 91.70% | 0.26% | 5.61% | NA |
| Tropical Japonica | 504 | 15.90% | 26.40% | 3.37% | 54.37% | NA |
| Japonica Intermediate | 241 | 12.00% | 70.50% | 0.83% | 16.60% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 28.90% | 41.10% | 4.44% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125171187 | C -> T | LOC_Os11g41850.1 | upstream_gene_variant ; 3441.0bp to feature; MODIFIER | silent_mutation | Average:44.885; most accessible tissue: Callus, score: 98.666 | N | N | N | N |
| vg1125171187 | C -> T | LOC_Os11g41860.1 | upstream_gene_variant ; 532.0bp to feature; MODIFIER | silent_mutation | Average:44.885; most accessible tissue: Callus, score: 98.666 | N | N | N | N |
| vg1125171187 | C -> T | LOC_Os11g41860.2 | upstream_gene_variant ; 511.0bp to feature; MODIFIER | silent_mutation | Average:44.885; most accessible tissue: Callus, score: 98.666 | N | N | N | N |
| vg1125171187 | C -> T | LOC_Os11g41870.1 | downstream_gene_variant ; 3827.0bp to feature; MODIFIER | silent_mutation | Average:44.885; most accessible tissue: Callus, score: 98.666 | N | N | N | N |
| vg1125171187 | C -> T | LOC_Os11g41850-LOC_Os11g41860 | intergenic_region ; MODIFIER | silent_mutation | Average:44.885; most accessible tissue: Callus, score: 98.666 | N | N | N | N |
| vg1125171187 | C -> DEL | N | N | silent_mutation | Average:44.885; most accessible tissue: Callus, score: 98.666 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125171187 | 2.86E-09 | 1.68E-08 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125171187 | 2.88E-08 | 2.69E-10 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125171187 | NA | 5.15E-07 | mr1745 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125171187 | NA | 1.67E-08 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125171187 | 1.43E-10 | 3.63E-09 | mr1662_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125171187 | 4.78E-09 | 1.31E-12 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125171187 | NA | 2.56E-06 | mr1745_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |