\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125171187:

Variant ID: vg1125171187 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25171187
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


GATAGCTTTGCTCTCTCTCTTCATTTAATATATTCCAAGTAGGAAAATATGCTGACATGGATCTCTTGTAGAGAGCTTATAGATAACTATTGTGGGTGCC[C/T]
TAAGGATATACTAGCTTGCTGATGAGGCCCTATTACTACTTTTTTTTTACAAATTAAATTTAAAGCAATTTAACTTTAATTAAAGTTTAAATAACTTATA

Reverse complement sequence

TATAAGTTATTTAAACTTTAATTAAAGTTAAATTGCTTTAAATTTAATTTGTAAAAAAAAAGTAGTAATAGGGCCTCATCAGCAAGCTAGTATATCCTTA[G/A]
GGCACCCACAATAGTTATCTATAAGCTCTCTACAAGAGATCCATGTCAGCATATTTTCCTACTTGGAATATATTAAATGAAGAGAGAGAGCAAAGCTATC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.80% 31.20% 1.80% 35.19% NA
All Indica  2759 47.20% 9.40% 1.56% 41.86% NA
All Japonica  1512 8.50% 66.50% 1.39% 23.61% NA
Aus  269 17.50% 28.60% 6.32% 47.58% NA
Indica I  595 32.90% 3.40% 2.69% 61.01% NA
Indica II  465 43.40% 17.20% 0.86% 38.49% NA
Indica III  913 55.60% 4.70% 1.42% 38.23% NA
Indica Intermediate  786 50.50% 14.60% 1.27% 33.59% NA
Temperate Japonica  767 2.50% 91.70% 0.26% 5.61% NA
Tropical Japonica  504 15.90% 26.40% 3.37% 54.37% NA
Japonica Intermediate  241 12.00% 70.50% 0.83% 16.60% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 28.90% 41.10% 4.44% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125171187 C -> T LOC_Os11g41850.1 upstream_gene_variant ; 3441.0bp to feature; MODIFIER silent_mutation Average:44.885; most accessible tissue: Callus, score: 98.666 N N N N
vg1125171187 C -> T LOC_Os11g41860.1 upstream_gene_variant ; 532.0bp to feature; MODIFIER silent_mutation Average:44.885; most accessible tissue: Callus, score: 98.666 N N N N
vg1125171187 C -> T LOC_Os11g41860.2 upstream_gene_variant ; 511.0bp to feature; MODIFIER silent_mutation Average:44.885; most accessible tissue: Callus, score: 98.666 N N N N
vg1125171187 C -> T LOC_Os11g41870.1 downstream_gene_variant ; 3827.0bp to feature; MODIFIER silent_mutation Average:44.885; most accessible tissue: Callus, score: 98.666 N N N N
vg1125171187 C -> T LOC_Os11g41850-LOC_Os11g41860 intergenic_region ; MODIFIER silent_mutation Average:44.885; most accessible tissue: Callus, score: 98.666 N N N N
vg1125171187 C -> DEL N N silent_mutation Average:44.885; most accessible tissue: Callus, score: 98.666 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125171187 2.86E-09 1.68E-08 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125171187 2.88E-08 2.69E-10 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125171187 NA 5.15E-07 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125171187 NA 1.67E-08 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125171187 1.43E-10 3.63E-09 mr1662_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125171187 4.78E-09 1.31E-12 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125171187 NA 2.56E-06 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251