Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1125166964:

Variant ID: vg1125166964 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25166964
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGGTGCGCACGAGCACCGCGCGCGCGTCGGCGTGGCGACCGCGCATGGCGAGCCAGCGCGGCGACTCCGGCATGGCGAGCACGCCCGCGGCGAGGAACAC[C/G]
GGCGGGAGCACGCCGATGCCGTACATGACGCGCCACCCGACGTGCACCGGCAATCCGGCCAACGCGTAGTTCGACACGTAGCTCAGCAAGATCCCGACGT

Reverse complement sequence

ACGTCGGGATCTTGCTGAGCTACGTGTCGAACTACGCGTTGGCCGGATTGCCGGTGCACGTCGGGTGGCGCGTCATGTACGGCATCGGCGTGCTCCCGCC[G/C]
GTGTTCCTCGCCGCGGGCGTGCTCGCCATGCCGGAGTCGCCGCGCTGGCTCGCCATGCGCGGTCGCCACGCCGACGCGCGCGCGGTGCTCGTGCGCACCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.40%	8.60%	0.02%	0.00%	NA
All Indica	2759	89.20%	10.70%	0.04%	0.00%	NA
All Japonica	1512	93.30%	6.70%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	84.30%	15.70%	0.00%	0.00%	NA
Indica III	913	85.80%	14.20%	0.00%	0.00%	NA
Indica Intermediate	786	88.50%	11.30%	0.13%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	82.30%	17.70%	0.00%	0.00%	NA
Japonica Intermediate	241	95.40%	4.60%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125166964	C -> G	LOC_Os11g41850.1	synonymous_variant ; p.Pro197Pro; LOW	synonymous_codon	Average:85.923; most accessible tissue: Zhenshan97 flower, score: 93.614	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1125166964	C	G	0.05	0.03	0.06	0.02	0.06	0.06

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125166964	NA	2.43E-06	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125166964	NA	2.32E-08	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125166964	8.90E-07	1.87E-06	mr1808	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125166964	NA	2.73E-06	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125166964	NA	1.57E-07	mr1892	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125166964	NA	9.53E-06	mr1892	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125166964	4.54E-07	NA	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125166964	NA	3.60E-06	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125166964	NA	6.50E-06	mr1218_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125166964	NA	1.08E-06	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251