\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125162956:

Variant ID: vg1125162956 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25162956
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTCTACAAACACTCTCAAACCACCACGTATGATTTCTACAAACGCTTCTAAATCACCAAATGACGCTCATAAGTTGCTCAAATAAATTAGATGAATTT[C/T]
CAATAATACTAAAATATATATCTAACCATTGATTTTACGTTAAATACGGCGGACCCACTATTTTCAATCATTGGATTTACATGTAAGACCACTGCAAAAT

Reverse complement sequence

ATTTTGCAGTGGTCTTACATGTAAATCCAATGATTGAAAATAGTGGGTCCGCCGTATTTAACGTAAAATCAATGGTTAGATATATATTTTAGTATTATTG[G/A]
AAATTCATCTAATTTATTTGAGCAACTTATGAGCGTCATTTGGTGATTTAGAAGCGTTTGTAGAAATCATACGTGGTGGTTTGAGAGTGTTTGTAGAAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.50% 33.50% 0.08% 0.00% NA
All Indica  2759 48.20% 51.70% 0.07% 0.00% NA
All Japonica  1512 91.80% 8.10% 0.07% 0.00% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 36.30% 63.40% 0.34% 0.00% NA
Indica II  465 55.50% 44.50% 0.00% 0.00% NA
Indica III  913 43.50% 56.50% 0.00% 0.00% NA
Indica Intermediate  786 58.40% 41.60% 0.00% 0.00% NA
Temperate Japonica  767 97.50% 2.50% 0.00% 0.00% NA
Tropical Japonica  504 82.10% 17.70% 0.20% 0.00% NA
Japonica Intermediate  241 93.80% 6.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 72.20% 26.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125162956 C -> T LOC_Os11g41840.1 upstream_gene_variant ; 1313.0bp to feature; MODIFIER silent_mutation Average:31.369; most accessible tissue: Callus, score: 77.387 N N N N
vg1125162956 C -> T LOC_Os11g41850.1 downstream_gene_variant ; 2827.0bp to feature; MODIFIER silent_mutation Average:31.369; most accessible tissue: Callus, score: 77.387 N N N N
vg1125162956 C -> T LOC_Os11g41840-LOC_Os11g41850 intergenic_region ; MODIFIER silent_mutation Average:31.369; most accessible tissue: Callus, score: 77.387 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125162956 3.23E-06 NA mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162956 4.68E-08 4.60E-15 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162956 2.76E-09 1.13E-12 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162956 1.72E-13 1.18E-18 mr1644 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162956 9.40E-15 7.30E-18 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162956 3.08E-09 7.43E-23 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162956 2.99E-10 4.86E-18 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162956 NA 6.50E-06 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162956 NA 3.46E-14 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162956 NA 1.08E-06 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251