Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1125162956:

Variant ID: vg1125162956 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25162956
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

CTTTCTACAAACACTCTCAAACCACCACGTATGATTTCTACAAACGCTTCTAAATCACCAAATGACGCTCATAAGTTGCTCAAATAAATTAGATGAATTT[C/T]
CAATAATACTAAAATATATATCTAACCATTGATTTTACGTTAAATACGGCGGACCCACTATTTTCAATCATTGGATTTACATGTAAGACCACTGCAAAAT

Reverse complement sequence

ATTTTGCAGTGGTCTTACATGTAAATCCAATGATTGAAAATAGTGGGTCCGCCGTATTTAACGTAAAATCAATGGTTAGATATATATTTTAGTATTATTG[G/A]
AAATTCATCTAATTTATTTGAGCAACTTATGAGCGTCATTTGGTGATTTAGAAGCGTTTGTAGAAATCATACGTGGTGGTTTGAGAGTGTTTGTAGAAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.50%	33.50%	0.08%	0.00%	NA
All Indica	2759	48.20%	51.70%	0.07%	0.00%	NA
All Japonica	1512	91.80%	8.10%	0.07%	0.00%	NA
Aus	269	97.40%	2.60%	0.00%	0.00%	NA
Indica I	595	36.30%	63.40%	0.34%	0.00%	NA
Indica II	465	55.50%	44.50%	0.00%	0.00%	NA
Indica III	913	43.50%	56.50%	0.00%	0.00%	NA
Indica Intermediate	786	58.40%	41.60%	0.00%	0.00%	NA
Temperate Japonica	767	97.50%	2.50%	0.00%	0.00%	NA
Tropical Japonica	504	82.10%	17.70%	0.20%	0.00%	NA
Japonica Intermediate	241	93.80%	6.20%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	72.20%	26.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125162956	C -> T	LOC_Os11g41840.1	upstream_gene_variant ; 1313.0bp to feature; MODIFIER	silent_mutation	Average:31.369; most accessible tissue: Callus, score: 77.387	N	N	N	N
vg1125162956	C -> T	LOC_Os11g41850.1	downstream_gene_variant ; 2827.0bp to feature; MODIFIER	silent_mutation	Average:31.369; most accessible tissue: Callus, score: 77.387	N	N	N	N
vg1125162956	C -> T	LOC_Os11g41840-LOC_Os11g41850	intergenic_region ; MODIFIER	silent_mutation	Average:31.369; most accessible tissue: Callus, score: 77.387	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125162956	3.23E-06	NA	mr1133	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162956	4.68E-08	4.60E-15	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162956	2.76E-09	1.13E-12	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162956	1.72E-13	1.18E-18	mr1644	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162956	9.40E-15	7.30E-18	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162956	3.08E-09	7.43E-23	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162956	2.99E-10	4.86E-18	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162956	NA	6.50E-06	mr1218_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162956	NA	3.46E-14	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162956	NA	1.08E-06	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251