\
| Variant ID: vg1125162956 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25162956 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 209. )
CTTTCTACAAACACTCTCAAACCACCACGTATGATTTCTACAAACGCTTCTAAATCACCAAATGACGCTCATAAGTTGCTCAAATAAATTAGATGAATTT[C/T]
CAATAATACTAAAATATATATCTAACCATTGATTTTACGTTAAATACGGCGGACCCACTATTTTCAATCATTGGATTTACATGTAAGACCACTGCAAAAT
ATTTTGCAGTGGTCTTACATGTAAATCCAATGATTGAAAATAGTGGGTCCGCCGTATTTAACGTAAAATCAATGGTTAGATATATATTTTAGTATTATTG[G/A]
AAATTCATCTAATTTATTTGAGCAACTTATGAGCGTCATTTGGTGATTTAGAAGCGTTTGTAGAAATCATACGTGGTGGTTTGAGAGTGTTTGTAGAAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.50% | 33.50% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 48.20% | 51.70% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 91.80% | 8.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 36.30% | 63.40% | 0.34% | 0.00% | NA |
| Indica II | 465 | 55.50% | 44.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 43.50% | 56.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 58.40% | 41.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 82.10% | 17.70% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 26.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125162956 | C -> T | LOC_Os11g41840.1 | upstream_gene_variant ; 1313.0bp to feature; MODIFIER | silent_mutation | Average:31.369; most accessible tissue: Callus, score: 77.387 | N | N | N | N |
| vg1125162956 | C -> T | LOC_Os11g41850.1 | downstream_gene_variant ; 2827.0bp to feature; MODIFIER | silent_mutation | Average:31.369; most accessible tissue: Callus, score: 77.387 | N | N | N | N |
| vg1125162956 | C -> T | LOC_Os11g41840-LOC_Os11g41850 | intergenic_region ; MODIFIER | silent_mutation | Average:31.369; most accessible tissue: Callus, score: 77.387 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125162956 | 3.23E-06 | NA | mr1133 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125162956 | 4.68E-08 | 4.60E-15 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125162956 | 2.76E-09 | 1.13E-12 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125162956 | 1.72E-13 | 1.18E-18 | mr1644 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125162956 | 9.40E-15 | 7.30E-18 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125162956 | 3.08E-09 | 7.43E-23 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125162956 | 2.99E-10 | 4.86E-18 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125162956 | NA | 6.50E-06 | mr1218_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125162956 | NA | 3.46E-14 | mr1850_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125162956 | NA | 1.08E-06 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |