\
| Variant ID: vg1125147847 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25147847 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, G: 0.01, others allele: 0.00, population size: 263. )
TGGTGTCCTACAAGCAAGCATTTAAGTGTTCCTAGTATCGAATTGCTCTTAGTTAACCAGGATTGTCAATGCTATTTCTGTGTCCATATTTTTCTTCCTA[C/G]
TAGCCCGCTTGCATATTTTCCTTCTCATCTCCTAGTTTACCATAAAACTATCAGCATATCGCAAGAATTGTAAGCCATGTCACAGTAGGATTGAGCGGCA
TGCCGCTCAATCCTACTGTGACATGGCTTACAATTCTTGCGATATGCTGATAGTTTTATGGTAAACTAGGAGATGAGAAGGAAAATATGCAAGCGGGCTA[G/C]
TAGGAAGAAAAATATGGACACAGAAATAGCATTGACAATCCTGGTTAACTAAGAGCAATTCGATACTAGGAACACTTAAATGCTTGCTTGTAGGACACCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.60% | 5.30% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 83.60% | 16.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.50% | 7.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 57.30% | 40.60% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125147847 | C -> G | LOC_Os11g41820.1 | downstream_gene_variant ; 856.0bp to feature; MODIFIER | silent_mutation | Average:64.886; most accessible tissue: Zhenshan97 young leaf, score: 74.302 | N | N | N | N |
| vg1125147847 | C -> G | LOC_Os11g41820.2 | downstream_gene_variant ; 856.0bp to feature; MODIFIER | silent_mutation | Average:64.886; most accessible tissue: Zhenshan97 young leaf, score: 74.302 | N | N | N | N |
| vg1125147847 | C -> G | LOC_Os11g41800-LOC_Os11g41820 | intergenic_region ; MODIFIER | silent_mutation | Average:64.886; most accessible tissue: Zhenshan97 young leaf, score: 74.302 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125147847 | NA | 7.37E-06 | mr1216 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125147847 | 2.46E-06 | NA | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125147847 | 8.32E-16 | 8.10E-18 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125147847 | 9.22E-07 | NA | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125147847 | 8.02E-13 | 7.34E-14 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125147847 | NA | 9.30E-07 | mr1484 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125147847 | 5.98E-06 | NA | mr1841 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125147847 | 3.89E-08 | 2.38E-09 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125147847 | 3.93E-06 | 3.93E-06 | mr1900 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125147847 | 2.10E-14 | 1.70E-15 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125147847 | 7.62E-16 | 1.54E-16 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125147847 | 5.04E-06 | 6.38E-06 | mr1609_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125147847 | 2.37E-08 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125147847 | 8.54E-19 | 2.24E-19 | mr1841_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125147847 | 9.20E-11 | 6.64E-12 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125147847 | 1.85E-10 | 1.85E-10 | mr1945_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |