\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125146479:

Variant ID: vg1125146479 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25146479
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 336. )

Flanking Sequence (100 bp) in Reference Genome:


AATGTGCAGGTTGAACCAAATCAATTTTGTGCAATATGACCGAAAGATGTGTTGTACCAAAAGTAGAACGCACGATCAATCAACTTATTGGCTCCTATGA[T/C]
TACTTACACATCATATCTGCAATGTCAATGTTTTCCCTTCCTTTCCATGGAGTAGCAAAGTATATAGATTATTGTCAATTTGTCATGCATGATCATTTGA

Reverse complement sequence

TCAAATGATCATGCATGACAAATTGACAATAATCTATATACTTTGCTACTCCATGGAAAGGAAGGGAAAACATTGACATTGCAGATATGATGTGTAAGTA[A/G]
TCATAGGAGCCAATAAGTTGATTGATCGTGCGTTCTACTTTTGGTACAACACATCTTTCGGTCATATTGCACAAAATTGATTTGGTTCAACCTGCACATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.20% 12.70% 0.02% 0.00% NA
All Indica  2759 80.70% 19.30% 0.04% 0.00% NA
All Japonica  1512 95.80% 4.20% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.00% 2.00% 0.00% 0.00% NA
Indica II  465 83.20% 16.80% 0.00% 0.00% NA
Indica III  913 68.30% 31.70% 0.00% 0.00% NA
Indica Intermediate  786 80.40% 19.50% 0.13% 0.00% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 90.30% 9.70% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125146479 T -> C LOC_Os11g41820.1 downstream_gene_variant ; 2224.0bp to feature; MODIFIER silent_mutation Average:37.53; most accessible tissue: Callus, score: 77.188 N N N N
vg1125146479 T -> C LOC_Os11g41820.2 downstream_gene_variant ; 2224.0bp to feature; MODIFIER silent_mutation Average:37.53; most accessible tissue: Callus, score: 77.188 N N N N
vg1125146479 T -> C LOC_Os11g41800-LOC_Os11g41820 intergenic_region ; MODIFIER silent_mutation Average:37.53; most accessible tissue: Callus, score: 77.188 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125146479 2.11E-08 NA mr1133 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125146479 1.27E-07 2.37E-08 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125146479 1.30E-06 NA mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125146479 NA 4.52E-08 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125146479 NA 3.52E-06 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251