\
| Variant ID: vg1125145452 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25145452 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, G: 0.06, others allele: 0.00, population size: 191. )
TAGTACATCTTTCTAAGAGATGTAAAACAGCAACTCAATAGAATTATTGAAATGTACTCAGGGTTTTTATTACAGGTGACAAAAAAGAATATGAGAGTAG[T/G]
GGTAATCGGGATTTATCAGAATTATATCGCCATAGACAAAATAAGCAAAATTTGAAAAAAAAAATTGGACAAAATTATGTATTACACCTACCCCTGTTGC
GCAACAGGGGTAGGTGTAATACATAATTTTGTCCAATTTTTTTTTTCAAATTTTGCTTATTTTGTCTATGGCGATATAATTCTGATAAATCCCGATTACC[A/C]
CTACTCTCATATTCTTTTTTGTCACCTGTAATAAAAACCCTGAGTACATTTCAATAATTCTATTGAGTTGCTGTTTTACATCTCTTAGAAAGATGTACTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.90% | 34.90% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 52.20% | 47.60% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 56.50% | 43.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 63.00% | 36.60% | 0.34% | 0.00% | NA |
| Indica II | 465 | 76.10% | 23.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 29.70% | 70.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 55.90% | 43.40% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 70.00% | 30.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.10% | 14.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125145452 | T -> G | LOC_Os11g41820.1 | downstream_gene_variant ; 3251.0bp to feature; MODIFIER | silent_mutation | Average:39.264; most accessible tissue: Callus, score: 79.395 | N | N | N | N |
| vg1125145452 | T -> G | LOC_Os11g41820.2 | downstream_gene_variant ; 3251.0bp to feature; MODIFIER | silent_mutation | Average:39.264; most accessible tissue: Callus, score: 79.395 | N | N | N | N |
| vg1125145452 | T -> G | LOC_Os11g41800-LOC_Os11g41820 | intergenic_region ; MODIFIER | silent_mutation | Average:39.264; most accessible tissue: Callus, score: 79.395 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125145452 | 1.70E-08 | 3.78E-21 | mr1133 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125145452 | 1.54E-07 | 4.52E-12 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125145452 | NA | 6.47E-06 | mr1925 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125145452 | 3.19E-06 | 2.07E-16 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125145452 | NA | 1.00E-09 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125145452 | NA | 6.62E-11 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125145452 | NA | 9.17E-07 | mr1667_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |