\
| Variant ID: vg1125121217 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25121217 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.70, C: 0.30, others allele: 0.00, population size: 222. )
ATAGAATGCTTACATCCCTGTCCCACCCAGTCTAAGGCATGAACTCGAATGACCCTTAACGCGGCACCATCATCATATTTCCTATGGCAGCATGCCCCAA[C/A]
ACTGCCAAATTCATATGGGAATTAAACTAGCAGGGAGTAGGCAACTCGATTTTTTGATGGCATTGGTACAGCGCAGTGCCAGTGTTGGTAACTATCGCGG
CCGCGATAGTTACCAACACTGGCACTGCGCTGTACCAATGCCATCAAAAAATCGAGTTGCCTACTCCCTGCTAGTTTAATTCCCATATGAATTTGGCAGT[G/T]
TTGGGGCATGCTGCCATAGGAAATATGATGATGGTGCCGCGTTAAGGGTCATTCGAGTTCATGCCTTAGACTGGGTGGGACAGGGATGTAAGCATTCTAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.10% | 32.80% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 92.60% | 7.30% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 27.50% | 72.40% | 0.07% | 0.00% | NA |
| Aus | 269 | 46.10% | 53.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.30% | 2.40% | 0.34% | 0.00% | NA |
| Indica II | 465 | 85.40% | 14.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 87.40% | 12.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 8.60% | 91.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 55.80% | 44.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 28.60% | 71.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 22.90% | 77.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 40.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125121217 | C -> A | LOC_Os11g41800-LOC_Os11g41820 | intergenic_region ; MODIFIER | silent_mutation | Average:48.593; most accessible tissue: Zhenshan97 young leaf, score: 74.675 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125121217 | 1.32E-14 | 4.51E-16 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125121217 | 2.36E-12 | 3.75E-14 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125121217 | NA | 2.98E-11 | mr1580 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125121217 | NA | 1.24E-07 | mr1723 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125121217 | 4.98E-09 | 1.03E-10 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125121217 | 5.40E-07 | 5.40E-07 | mr1900 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125121217 | 6.88E-13 | 3.98E-13 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125121217 | NA | 6.11E-06 | mr1425_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125121217 | 3.47E-13 | 1.89E-13 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125121217 | 4.48E-16 | 2.40E-17 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125121217 | 1.72E-10 | 4.30E-11 | mr1900_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125121217 | 4.61E-10 | 4.61E-10 | mr1945_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |