Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125116259:

Variant ID: vg1125116259 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25116259
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


CGGACCTACCCAGTAGTCGCACTAATTCTTGTAGGCTGTACTATCCTGATTCCTTGTCGCTCCACCCTTGTGGTACTTCGGTATCCGTGCTCTCTGAGCG[C/T]
GTATACCTAATATCCCACATACACCGTTGATTATCGAAAACTTGGGAAATGGGTTTGTGAAGCCTTCAAAATCTGACATGTGGTGTCGGTGTGTTTGAAA

Reverse complement sequence

TTTCAAACACACCGACACCACATGTCAGATTTTGAAGGCTTCACAAACCCATTTCCCAAGTTTTCGATAATCAACGGTGTATGTGGGATATTAGGTATAC[G/A]
CGCTCAGAGAGCACGGATACCGAAGTACCACAAGGGTGGAGCGACAAGGAATCAGGATAGTACAGCCTACAAGAATTAGTGCGACTACTGGGTAGGTCCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.20% 5.10% 0.11% 1.61% NA
All Indica  2759 98.60% 0.10% 0.11% 1.20% NA
All Japonica  1512 84.70% 15.30% 0.00% 0.00% NA
Aus  269 88.10% 1.10% 0.74% 10.04% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 96.30% 0.00% 0.22% 3.44% NA
Indica III  913 99.70% 0.10% 0.11% 0.11% NA
Indica Intermediate  786 97.60% 0.30% 0.13% 2.04% NA
Temperate Japonica  767 76.50% 23.50% 0.00% 0.00% NA
Tropical Japonica  504 96.40% 3.60% 0.00% 0.00% NA
Japonica Intermediate  241 86.30% 13.70% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 1.00% 0.00% 11.46% NA
Intermediate  90 93.30% 1.10% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125116259 C -> T LOC_Os11g41800.1 downstream_gene_variant ; 2766.0bp to feature; MODIFIER silent_mutation Average:28.275; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 N N N N
vg1125116259 C -> T LOC_Os11g41800-LOC_Os11g41820 intergenic_region ; MODIFIER silent_mutation Average:28.275; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 N N N N
vg1125116259 C -> DEL N N silent_mutation Average:28.275; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125116259 4.62E-24 7.26E-27 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 9.43E-15 1.16E-09 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 7.24E-14 NA mr1300 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 1.36E-08 NA mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 9.31E-21 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 5.13E-16 1.00E-09 mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 7.91E-15 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 5.82E-08 NA mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 2.44E-18 2.07E-21 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 9.85E-14 4.92E-10 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 9.30E-07 NA mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 6.30E-06 NA mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 8.92E-17 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 1.98E-12 4.28E-09 mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 2.89E-17 9.42E-17 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 1.92E-15 2.70E-08 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 1.36E-15 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 6.77E-09 NA mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 3.94E-07 2.45E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 1.31E-06 1.31E-06 mr1945 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 8.88E-09 NA mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 1.64E-06 NA mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 2.29E-22 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 5.85E-16 7.60E-11 mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 1.52E-13 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 2.76E-08 NA mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 4.35E-24 5.67E-29 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 5.15E-12 5.16E-12 mr1484_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 5.57E-13 NA mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 8.82E-08 8.83E-08 mr1609_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 1.61E-24 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 1.17E-17 1.15E-11 mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 9.36E-20 1.31E-22 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 2.50E-15 1.37E-10 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 4.38E-19 1.87E-23 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 6.58E-11 6.58E-11 mr1945_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 9.39E-10 NA mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259 4.17E-07 NA mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251