Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1125116259:

Variant ID: vg1125116259 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25116259
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

CGGACCTACCCAGTAGTCGCACTAATTCTTGTAGGCTGTACTATCCTGATTCCTTGTCGCTCCACCCTTGTGGTACTTCGGTATCCGTGCTCTCTGAGCG[C/T]
GTATACCTAATATCCCACATACACCGTTGATTATCGAAAACTTGGGAAATGGGTTTGTGAAGCCTTCAAAATCTGACATGTGGTGTCGGTGTGTTTGAAA

Reverse complement sequence

TTTCAAACACACCGACACCACATGTCAGATTTTGAAGGCTTCACAAACCCATTTCCCAAGTTTTCGATAATCAACGGTGTATGTGGGATATTAGGTATAC[G/A]
CGCTCAGAGAGCACGGATACCGAAGTACCACAAGGGTGGAGCGACAAGGAATCAGGATAGTACAGCCTACAAGAATTAGTGCGACTACTGGGTAGGTCCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.20%	5.10%	0.11%	1.61%	NA
All Indica	2759	98.60%	0.10%	0.11%	1.20%	NA
All Japonica	1512	84.70%	15.30%	0.00%	0.00%	NA
Aus	269	88.10%	1.10%	0.74%	10.04%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	96.30%	0.00%	0.22%	3.44%	NA
Indica III	913	99.70%	0.10%	0.11%	0.11%	NA
Indica Intermediate	786	97.60%	0.30%	0.13%	2.04%	NA
Temperate Japonica	767	76.50%	23.50%	0.00%	0.00%	NA
Tropical Japonica	504	96.40%	3.60%	0.00%	0.00%	NA
Japonica Intermediate	241	86.30%	13.70%	0.00%	0.00%	NA
VI/Aromatic	96	87.50%	1.00%	0.00%	11.46%	NA
Intermediate	90	93.30%	1.10%	0.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125116259	C -> T	LOC_Os11g41800.1	downstream_gene_variant ; 2766.0bp to feature; MODIFIER	silent_mutation	Average:28.275; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg1125116259	C -> T	LOC_Os11g41800-LOC_Os11g41820	intergenic_region ; MODIFIER	silent_mutation	Average:28.275; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg1125116259	C -> DEL	N	N	silent_mutation	Average:28.275; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125116259	4.62E-24	7.26E-27	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	9.43E-15	1.16E-09	mr1238	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	7.24E-14	NA	mr1300	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	1.36E-08	NA	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	9.31E-21	NA	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	5.13E-16	1.00E-09	mr1309	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	7.91E-15	NA	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	5.82E-08	NA	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	2.44E-18	2.07E-21	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	9.85E-14	4.92E-10	mr1484	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	9.30E-07	NA	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	6.30E-06	NA	mr1609	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	8.92E-17	NA	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	1.98E-12	4.28E-09	mr1841	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	2.89E-17	9.42E-17	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	1.92E-15	2.70E-08	mr1900	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	1.36E-15	NA	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	6.77E-09	NA	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	3.94E-07	2.45E-10	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	1.31E-06	1.31E-06	mr1945	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	8.88E-09	NA	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	1.64E-06	NA	mr1959	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	2.29E-22	NA	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	5.85E-16	7.60E-11	mr1238_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	1.52E-13	NA	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	2.76E-08	NA	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	4.35E-24	5.67E-29	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	5.15E-12	5.16E-12	mr1484_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	5.57E-13	NA	mr1609_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	8.82E-08	8.83E-08	mr1609_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	1.61E-24	NA	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	1.17E-17	1.15E-11	mr1841_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	9.36E-20	1.31E-22	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	2.50E-15	1.37E-10	mr1900_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	4.38E-19	1.87E-23	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	6.58E-11	6.58E-11	mr1945_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	9.39E-10	NA	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116259	4.17E-07	NA	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251