\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125089136:

Variant ID: vg1125089136 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25089136
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, A: 0.22, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:


ATAATGTACCTTTTTGCGAGTAGTTTTTATAGTAGAAAAAAGATCTCATGTTTCAAAGCAGTATATATACAATGTGCAGTCCACTACTATTCCTATATCC[A/G]
TATATAAATAAAATGTAAATTTGTTTGGTACTCCATGGTGCCCGGGCTCTATAAATATATGTATATTTTATGTATATGCAATATTATTATGTAAAAAAAT

Reverse complement sequence

ATTTTTTTACATAATAATATTGCATATACATAAAATATACATATATTTATAGAGCCCGGGCACCATGGAGTACCAAACAAATTTACATTTTATTTATATA[T/C]
GGATATAGGAATAGTAGTGGACTGCACATTGTATATATACTGCTTTGAAACATGAGATCTTTTTTCTACTATAAAAACTACTCGCAAAAAGGTACATTAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.00% 31.90% 0.32% 4.80% NA
All Indica  2759 67.50% 31.70% 0.22% 0.65% NA
All Japonica  1512 61.60% 24.50% 0.53% 13.36% NA
Aus  269 30.50% 68.40% 0.00% 1.12% NA
Indica I  595 63.00% 36.60% 0.34% 0.00% NA
Indica II  465 61.70% 38.10% 0.22% 0.00% NA
Indica III  913 73.40% 26.20% 0.00% 0.44% NA
Indica Intermediate  786 67.30% 30.50% 0.38% 1.78% NA
Temperate Japonica  767 60.80% 16.70% 0.91% 21.64% NA
Tropical Japonica  504 67.30% 31.00% 0.00% 1.79% NA
Japonica Intermediate  241 52.30% 36.10% 0.41% 11.20% NA
VI/Aromatic  96 50.00% 47.90% 1.04% 1.04% NA
Intermediate  90 61.10% 35.60% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125089136 A -> DEL N N silent_mutation Average:53.036; most accessible tissue: Minghui63 panicle, score: 87.605 N N N N
vg1125089136 A -> G LOC_Os11g41760-LOC_Os11g41770 intergenic_region ; MODIFIER silent_mutation Average:53.036; most accessible tissue: Minghui63 panicle, score: 87.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125089136 NA 1.61E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125089136 NA 2.47E-09 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125089136 6.17E-07 8.92E-12 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125089136 NA 7.25E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125089136 NA 4.40E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125089136 NA 7.82E-10 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125089136 2.35E-07 2.22E-12 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125089136 NA 6.58E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125089136 NA 6.79E-07 mr1170_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125089136 NA 8.06E-16 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125089136 6.05E-08 2.88E-19 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125089136 NA 2.29E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125089136 NA 1.03E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125089136 NA 1.95E-06 mr1362_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125089136 NA 8.36E-07 mr1555_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125089136 NA 7.91E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125089136 NA 3.38E-07 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125089136 1.63E-06 4.10E-07 mr1662_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125089136 NA 3.54E-06 mr1763_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251