Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125079769:

Variant ID: vg1125079769 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25079769
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.74, G: 0.21, A: 0.06, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:

TAGAAGATAGACAAAAATGTTAATTGCTCCTCCCATTGTCAAAAAGATATACTCAAAATTTAGCATTCAAAATTTATCTCAAAGTATATATATTTACGTC[G/T]
CCACGTACCCATCATCTTAACCTACCACACAACAATTTTCTATTTAATTTCACCACCTACTACATTATCTCAACCAATCCGAACTTTCTTTCTATCAATT

Reverse complement sequence

AATTGATAGAAAGAAAGTTCGGATTGGTTGAGATAATGTAGTAGGTGGTGAAATTAAATAGAAAATTGTTGTGTGGTAGGTTAAGATGATGGGTACGTGG[C/A]
GACGTAAATATATATACTTTGAGATAAATTTTGAATGCTAAATTTTGAGTATATCTTTTTGACAATGGGAGGAGCAATTAACATTTTTGTCTATCTTCTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.70%	37.80%	0.21%	5.33%	NA
All Indica	2759	70.40%	28.10%	0.14%	1.38%	NA
All Japonica	1512	30.40%	55.70%	0.40%	13.56%	NA
Aus	269	67.70%	30.90%	0.00%	1.49%	NA
Indica I	595	62.50%	36.50%	0.50%	0.50%	NA
Indica II	465	56.60%	43.40%	0.00%	0.00%	NA
Indica III	913	85.10%	14.50%	0.00%	0.44%	NA
Indica Intermediate	786	67.30%	28.60%	0.13%	3.94%	NA
Temperate Japonica	767	12.60%	64.50%	0.78%	22.03%	NA
Tropical Japonica	504	56.90%	41.30%	0.00%	1.79%	NA
Japonica Intermediate	241	31.10%	57.70%	0.00%	11.20%	NA
VI/Aromatic	96	51.00%	46.90%	0.00%	2.08%	NA
Intermediate	90	52.20%	44.40%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125079769	G -> T	LOC_Os11g41760.1	upstream_gene_variant ; 2743.0bp to feature; MODIFIER	silent_mutation	Average:38.015; most accessible tissue: Callus, score: 69.162	N	N	N	N
vg1125079769	G -> T	LOC_Os11g41760-LOC_Os11g41770	intergenic_region ; MODIFIER	silent_mutation	Average:38.015; most accessible tissue: Callus, score: 69.162	N	N	N	N
vg1125079769	G -> DEL	N	N	silent_mutation	Average:38.015; most accessible tissue: Callus, score: 69.162	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125079769	3.97E-09	9.23E-13	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769	5.35E-10	NA	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769	1.07E-10	2.97E-11	mr1238	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769	2.31E-08	NA	mr1309	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769	5.34E-09	5.47E-09	mr1309	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769	1.42E-09	NA	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769	1.07E-10	2.56E-11	mr1484	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769	9.27E-09	9.58E-15	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769	3.57E-10	NA	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769	6.49E-10	2.70E-10	mr1841	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769	4.58E-08	NA	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769	2.39E-10	1.44E-11	mr1900	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769	1.82E-06	6.53E-15	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769	1.57E-10	NA	mr1238_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769	1.41E-10	3.84E-11	mr1238_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769	1.67E-06	3.41E-07	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769	2.15E-09	NA	mr1484_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769	1.85E-10	1.85E-10	mr1484_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769	9.05E-07	9.05E-07	mr1609_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769	1.23E-11	NA	mr1841_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769	5.06E-11	4.02E-11	mr1841_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769	2.45E-08	NA	mr1900_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769	1.84E-09	4.60E-10	mr1900_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769	7.55E-09	NA	mr1945_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769	8.66E-11	8.66E-11	mr1945_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251