\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125079769:

Variant ID: vg1125079769 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25079769
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.74, G: 0.21, A: 0.06, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:


TAGAAGATAGACAAAAATGTTAATTGCTCCTCCCATTGTCAAAAAGATATACTCAAAATTTAGCATTCAAAATTTATCTCAAAGTATATATATTTACGTC[G/T]
CCACGTACCCATCATCTTAACCTACCACACAACAATTTTCTATTTAATTTCACCACCTACTACATTATCTCAACCAATCCGAACTTTCTTTCTATCAATT

Reverse complement sequence

AATTGATAGAAAGAAAGTTCGGATTGGTTGAGATAATGTAGTAGGTGGTGAAATTAAATAGAAAATTGTTGTGTGGTAGGTTAAGATGATGGGTACGTGG[C/A]
GACGTAAATATATATACTTTGAGATAAATTTTGAATGCTAAATTTTGAGTATATCTTTTTGACAATGGGAGGAGCAATTAACATTTTTGTCTATCTTCTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.70% 37.80% 0.21% 5.33% NA
All Indica  2759 70.40% 28.10% 0.14% 1.38% NA
All Japonica  1512 30.40% 55.70% 0.40% 13.56% NA
Aus  269 67.70% 30.90% 0.00% 1.49% NA
Indica I  595 62.50% 36.50% 0.50% 0.50% NA
Indica II  465 56.60% 43.40% 0.00% 0.00% NA
Indica III  913 85.10% 14.50% 0.00% 0.44% NA
Indica Intermediate  786 67.30% 28.60% 0.13% 3.94% NA
Temperate Japonica  767 12.60% 64.50% 0.78% 22.03% NA
Tropical Japonica  504 56.90% 41.30% 0.00% 1.79% NA
Japonica Intermediate  241 31.10% 57.70% 0.00% 11.20% NA
VI/Aromatic  96 51.00% 46.90% 0.00% 2.08% NA
Intermediate  90 52.20% 44.40% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125079769 G -> T LOC_Os11g41760.1 upstream_gene_variant ; 2743.0bp to feature; MODIFIER silent_mutation Average:38.015; most accessible tissue: Callus, score: 69.162 N N N N
vg1125079769 G -> T LOC_Os11g41760-LOC_Os11g41770 intergenic_region ; MODIFIER silent_mutation Average:38.015; most accessible tissue: Callus, score: 69.162 N N N N
vg1125079769 G -> DEL N N silent_mutation Average:38.015; most accessible tissue: Callus, score: 69.162 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125079769 3.97E-09 9.23E-13 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769 5.35E-10 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769 1.07E-10 2.97E-11 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769 2.31E-08 NA mr1309 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769 5.34E-09 5.47E-09 mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769 1.42E-09 NA mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769 1.07E-10 2.56E-11 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769 9.27E-09 9.58E-15 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769 3.57E-10 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769 6.49E-10 2.70E-10 mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769 4.58E-08 NA mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769 2.39E-10 1.44E-11 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769 1.82E-06 6.53E-15 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769 1.57E-10 NA mr1238_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769 1.41E-10 3.84E-11 mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769 1.67E-06 3.41E-07 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769 2.15E-09 NA mr1484_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769 1.85E-10 1.85E-10 mr1484_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769 9.05E-07 9.05E-07 mr1609_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769 1.23E-11 NA mr1841_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769 5.06E-11 4.02E-11 mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769 2.45E-08 NA mr1900_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769 1.84E-09 4.60E-10 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769 7.55E-09 NA mr1945_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079769 8.66E-11 8.66E-11 mr1945_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251