\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125077990:

Variant ID: vg1125077990 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25077990
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.70, G: 0.30, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


GTTTTAATTTACCTCGCACTATCTCGCGCGGCTTGTTTAAAAAATATAATATATGTAGAGTATACAACTCTACAGCTTTTAGTGGATAGATTGTCCGATG[A/G]
TATTGATATCTGCTGGTCATGTAGTTTTATTGTCTGCACTTTGTAGCTTGAAAGCCAAAGCGTCTTTTTTGAAAGATAATATACATTGGCCGCCTATACT

Reverse complement sequence

AGTATAGGCGGCCAATGTATATTATCTTTCAAAAAAGACGCTTTGGCTTTCAAGCTACAAAGTGCAGACAATAAAACTACATGACCAGCAGATATCAATA[T/C]
CATCGGACAATCTATCCACTAAAAGCTGTAGAGTTGTATACTCTACATATATTATATTTTTTAAACAAGCCGCGCGAGATAGTGCGAGGTAAATTAAAAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.90% 39.10% 0.91% 0.11% NA
All Indica  2759 50.20% 48.20% 1.38% 0.18% NA
All Japonica  1512 81.20% 18.70% 0.07% 0.00% NA
Aus  269 42.00% 57.60% 0.37% 0.00% NA
Indica I  595 30.90% 67.60% 1.01% 0.50% NA
Indica II  465 59.60% 40.40% 0.00% 0.00% NA
Indica III  913 52.00% 47.60% 0.33% 0.00% NA
Indica Intermediate  786 57.30% 38.80% 3.69% 0.25% NA
Temperate Japonica  767 91.80% 8.20% 0.00% 0.00% NA
Tropical Japonica  504 64.10% 35.90% 0.00% 0.00% NA
Japonica Intermediate  241 83.40% 16.20% 0.41% 0.00% NA
VI/Aromatic  96 51.00% 47.90% 1.04% 0.00% NA
Intermediate  90 60.00% 37.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125077990 A -> DEL N N silent_mutation Average:61.368; most accessible tissue: Callus, score: 87.378 N N N N
vg1125077990 A -> G LOC_Os11g41760.1 upstream_gene_variant ; 964.0bp to feature; MODIFIER silent_mutation Average:61.368; most accessible tissue: Callus, score: 87.378 N N N N
vg1125077990 A -> G LOC_Os11g41760-LOC_Os11g41770 intergenic_region ; MODIFIER silent_mutation Average:61.368; most accessible tissue: Callus, score: 87.378 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125077990 NA 8.67E-07 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125077990 NA 4.33E-06 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125077990 NA 8.96E-07 mr1211 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125077990 NA 7.24E-06 mr1328 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125077990 NA 1.71E-08 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125077990 NA 2.59E-06 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125077990 8.96E-06 8.13E-10 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125077990 3.77E-06 1.17E-07 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125077990 NA 1.84E-07 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125077990 NA 7.38E-15 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125077990 NA 1.43E-11 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125077990 NA 8.01E-06 mr1425_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125077990 3.45E-08 1.33E-12 mr1662_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125077990 1.64E-08 1.58E-10 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125077990 NA 4.01E-07 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251