\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125024893:

Variant ID: vg1125024893 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25024893
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.83, C: 0.16, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GAAACCAAGAGTGCCACCGCCACTCAGTCTCTAGTCGAGCTCGCCGCCTCGCTTCTGTGTTTCATGCTTTCGGCCTAGCTTGGTGGATGCAGCCACCACA[T/C]
GATAGCTTAGCAGTCTTCGTCGATCGCCACCTCAAATCGGTCTAGGAGACCTGCCACTCGAAGCCGAGGAGCCCCAAGTCTTCATCCCCAAATCTGCTAG

Reverse complement sequence

CTAGCAGATTTGGGGATGAAGACTTGGGGCTCCTCGGCTTCGAGTGGCAGGTCTCCTAGACCGATTTGAGGTGGCGATCGACGAAGACTGCTAAGCTATC[A/G]
TGTGGTGGCTGCATCCACCAAGCTAGGCCGAAAGCATGAAACACAGAAGCGAGGCGGCGAGCTCGACTAGAGACTGAGTGGCGGTGGCACTCTTGGTTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.00% 34.60% 0.21% 3.20% NA
All Indica  2759 83.90% 12.90% 0.33% 2.94% NA
All Japonica  1512 23.50% 76.30% 0.00% 0.20% NA
Aus  269 68.80% 14.90% 0.37% 15.99% NA
Indica I  595 97.60% 2.40% 0.00% 0.00% NA
Indica II  465 70.80% 20.40% 0.22% 8.60% NA
Indica III  913 89.50% 10.30% 0.00% 0.22% NA
Indica Intermediate  786 74.70% 19.30% 1.02% 4.96% NA
Temperate Japonica  767 8.00% 91.80% 0.00% 0.26% NA
Tropical Japonica  504 39.30% 60.70% 0.00% 0.00% NA
Japonica Intermediate  241 40.20% 59.30% 0.00% 0.41% NA
VI/Aromatic  96 30.20% 50.00% 0.00% 19.79% NA
Intermediate  90 51.10% 43.30% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125024893 T -> DEL N N silent_mutation Average:72.843; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N
vg1125024893 T -> C LOC_Os11g41690.1 upstream_gene_variant ; 4957.0bp to feature; MODIFIER silent_mutation Average:72.843; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N
vg1125024893 T -> C LOC_Os11g41680.1 downstream_gene_variant ; 1198.0bp to feature; MODIFIER silent_mutation Average:72.843; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N
vg1125024893 T -> C LOC_Os11g41680-LOC_Os11g41690 intergenic_region ; MODIFIER silent_mutation Average:72.843; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125024893 2.48E-09 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125024893 5.02E-08 4.46E-08 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125024893 6.47E-07 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125024893 3.69E-07 2.65E-08 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125024893 4.40E-06 2.64E-14 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125024893 NA 1.09E-08 mr1609 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125024893 3.97E-07 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125024893 1.28E-07 3.06E-08 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125024893 NA 6.94E-13 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125024893 1.20E-10 1.10E-29 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125024893 NA 5.91E-07 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125024893 1.02E-08 5.05E-25 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125024893 NA 2.29E-06 mr1566_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125024893 2.88E-09 4.15E-28 mr1609_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125024893 8.64E-06 4.31E-10 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125024893 NA 2.41E-06 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125024893 NA 8.96E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125024893 1.86E-10 1.03E-31 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125024893 2.72E-06 3.38E-07 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125024893 1.38E-11 1.69E-24 mr1900_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125024893 2.42E-07 5.15E-08 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125024893 2.31E-07 2.74E-19 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251