\
| Variant ID: vg1124998850 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24998850 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.07, others allele: 0.00, population size: 232. )
GACCCCGGCCTTCATCAAACATGGATTTTATGGTTGCTTTTGCCTCGTTGGTGCCTAGCAACGGTGCATCCGGTTCCCATCCATTTTAGACGTGTTAATA[G/A]
TATAGTGACCTGGCCTTGTCGGCACTCGGCCATGGTTTCGTCTAGCCTCGTCGGTCATAGACAAATGAAATGAATGAATAGCTGTAGCCTTGTTAGCTTT
AAAGCTAACAAGGCTACAGCTATTCATTCATTTCATTTGTCTATGACCGACGAGGCTAGACGAAACCATGGCCGAGTGCCGACAAGGCCAGGTCACTATA[C/T]
TATTAACACGTCTAAAATGGATGGGAACCGGATGCACCGTTGCTAGGCACCAACGAGGCAAAAGCAACCATAAAATCCATGTTTGATGAAGGCCGGGGTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.20% | 33.70% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 52.20% | 47.60% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 88.20% | 11.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 86.20% | 13.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 38.50% | 61.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 59.10% | 40.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 57.00% | 42.80% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 53.10% | 46.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 71.40% | 28.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.40% | 11.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 64.60% | 34.40% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 33.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124998850 | G -> A | LOC_Os11g41650-LOC_Os11g41670 | intergenic_region ; MODIFIER | silent_mutation | Average:50.004; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124998850 | 1.35E-07 | NA | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124998850 | 5.04E-10 | 5.39E-13 | mr1191 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124998850 | 5.87E-08 | NA | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124998850 | 1.47E-10 | 5.02E-14 | mr1644 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124998850 | 1.32E-07 | NA | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124998850 | 2.82E-09 | 2.34E-15 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |