\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124975706:

Variant ID: vg1124975706 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24975706
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


TGAACGTGACGATATGTTTCTCCAACATTTTTGCTATATTTTTTAGAGGATGATGGATCAACTGTGCCGTCCAGTGTATATTTTTAGTTTGAGTAAAATA[C/T]
ATGGCCGGTCCTTAAACTTGAGCGCGGGTGTTACTTAGGTCCACAATCTTGTAAATTGCAGAGTCAAATCCACCATCTTAGTTTAATGATACATGGCAGG

Reverse complement sequence

CCTGCCATGTATCATTAAACTAAGATGGTGGATTTGACTCTGCAATTTACAAGATTGTGGACCTAAGTAACACCCGCGCTCAAGTTTAAGGACCGGCCAT[G/A]
TATTTTACTCAAACTAAAAATATACACTGGACGGCACAGTTGATCCATCATCCTCTAAAAAATATAGCAAAAATGTTGGAGAAACATATCGTCACGTTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.70% 42.60% 0.28% 3.51% NA
All Indica  2759 40.60% 55.70% 0.40% 3.26% NA
All Japonica  1512 80.10% 19.70% 0.00% 0.20% NA
Aus  269 42.40% 39.40% 0.74% 17.47% NA
Indica I  595 38.50% 61.00% 0.50% 0.00% NA
Indica II  465 47.30% 43.00% 0.43% 9.25% NA
Indica III  913 38.90% 60.80% 0.11% 0.22% NA
Indica Intermediate  786 40.20% 53.40% 0.64% 5.73% NA
Temperate Japonica  767 97.10% 2.60% 0.00% 0.26% NA
Tropical Japonica  504 61.10% 38.90% 0.00% 0.00% NA
Japonica Intermediate  241 65.60% 34.00% 0.00% 0.41% NA
VI/Aromatic  96 42.70% 36.50% 0.00% 20.83% NA
Intermediate  90 55.60% 37.80% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124975706 C -> T LOC_Os11g41620.1 upstream_gene_variant ; 442.0bp to feature; MODIFIER silent_mutation Average:60.798; most accessible tissue: Callus, score: 90.535 N N N N
vg1124975706 C -> T LOC_Os11g41610.1 downstream_gene_variant ; 656.0bp to feature; MODIFIER silent_mutation Average:60.798; most accessible tissue: Callus, score: 90.535 N N N N
vg1124975706 C -> T LOC_Os11g41630.1 downstream_gene_variant ; 4075.0bp to feature; MODIFIER silent_mutation Average:60.798; most accessible tissue: Callus, score: 90.535 N N N N
vg1124975706 C -> T LOC_Os11g41610-LOC_Os11g41620 intergenic_region ; MODIFIER silent_mutation Average:60.798; most accessible tissue: Callus, score: 90.535 N N N N
vg1124975706 C -> DEL N N silent_mutation Average:60.798; most accessible tissue: Callus, score: 90.535 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124975706 NA 4.02E-08 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975706 NA 3.67E-08 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975706 9.44E-06 NA mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975706 4.19E-06 4.01E-11 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975706 1.18E-06 NA mr1238_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975706 5.92E-06 5.92E-06 mr1579_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975706 2.13E-06 NA mr1841_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975706 2.14E-06 NA mr1900_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251