\
| Variant ID: vg1124975706 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24975706 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 115. )
TGAACGTGACGATATGTTTCTCCAACATTTTTGCTATATTTTTTAGAGGATGATGGATCAACTGTGCCGTCCAGTGTATATTTTTAGTTTGAGTAAAATA[C/T]
ATGGCCGGTCCTTAAACTTGAGCGCGGGTGTTACTTAGGTCCACAATCTTGTAAATTGCAGAGTCAAATCCACCATCTTAGTTTAATGATACATGGCAGG
CCTGCCATGTATCATTAAACTAAGATGGTGGATTTGACTCTGCAATTTACAAGATTGTGGACCTAAGTAACACCCGCGCTCAAGTTTAAGGACCGGCCAT[G/A]
TATTTTACTCAAACTAAAAATATACACTGGACGGCACAGTTGATCCATCATCCTCTAAAAAATATAGCAAAAATGTTGGAGAAACATATCGTCACGTTCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.70% | 42.60% | 0.28% | 3.51% | NA |
| All Indica | 2759 | 40.60% | 55.70% | 0.40% | 3.26% | NA |
| All Japonica | 1512 | 80.10% | 19.70% | 0.00% | 0.20% | NA |
| Aus | 269 | 42.40% | 39.40% | 0.74% | 17.47% | NA |
| Indica I | 595 | 38.50% | 61.00% | 0.50% | 0.00% | NA |
| Indica II | 465 | 47.30% | 43.00% | 0.43% | 9.25% | NA |
| Indica III | 913 | 38.90% | 60.80% | 0.11% | 0.22% | NA |
| Indica Intermediate | 786 | 40.20% | 53.40% | 0.64% | 5.73% | NA |
| Temperate Japonica | 767 | 97.10% | 2.60% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 61.10% | 38.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 65.60% | 34.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 42.70% | 36.50% | 0.00% | 20.83% | NA |
| Intermediate | 90 | 55.60% | 37.80% | 0.00% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124975706 | C -> T | LOC_Os11g41620.1 | upstream_gene_variant ; 442.0bp to feature; MODIFIER | silent_mutation | Average:60.798; most accessible tissue: Callus, score: 90.535 | N | N | N | N |
| vg1124975706 | C -> T | LOC_Os11g41610.1 | downstream_gene_variant ; 656.0bp to feature; MODIFIER | silent_mutation | Average:60.798; most accessible tissue: Callus, score: 90.535 | N | N | N | N |
| vg1124975706 | C -> T | LOC_Os11g41630.1 | downstream_gene_variant ; 4075.0bp to feature; MODIFIER | silent_mutation | Average:60.798; most accessible tissue: Callus, score: 90.535 | N | N | N | N |
| vg1124975706 | C -> T | LOC_Os11g41610-LOC_Os11g41620 | intergenic_region ; MODIFIER | silent_mutation | Average:60.798; most accessible tissue: Callus, score: 90.535 | N | N | N | N |
| vg1124975706 | C -> DEL | N | N | silent_mutation | Average:60.798; most accessible tissue: Callus, score: 90.535 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124975706 | NA | 4.02E-08 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124975706 | NA | 3.67E-08 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124975706 | 9.44E-06 | NA | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124975706 | 4.19E-06 | 4.01E-11 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124975706 | 1.18E-06 | NA | mr1238_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124975706 | 5.92E-06 | 5.92E-06 | mr1579_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124975706 | 2.13E-06 | NA | mr1841_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124975706 | 2.14E-06 | NA | mr1900_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |