Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1124975706:

Variant ID: vg1124975706 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24975706
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:

TGAACGTGACGATATGTTTCTCCAACATTTTTGCTATATTTTTTAGAGGATGATGGATCAACTGTGCCGTCCAGTGTATATTTTTAGTTTGAGTAAAATA[C/T]
ATGGCCGGTCCTTAAACTTGAGCGCGGGTGTTACTTAGGTCCACAATCTTGTAAATTGCAGAGTCAAATCCACCATCTTAGTTTAATGATACATGGCAGG

Reverse complement sequence

CCTGCCATGTATCATTAAACTAAGATGGTGGATTTGACTCTGCAATTTACAAGATTGTGGACCTAAGTAACACCCGCGCTCAAGTTTAAGGACCGGCCAT[G/A]
TATTTTACTCAAACTAAAAATATACACTGGACGGCACAGTTGATCCATCATCCTCTAAAAAATATAGCAAAAATGTTGGAGAAACATATCGTCACGTTCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.70%	42.60%	0.28%	3.51%	NA
All Indica	2759	40.60%	55.70%	0.40%	3.26%	NA
All Japonica	1512	80.10%	19.70%	0.00%	0.20%	NA
Aus	269	42.40%	39.40%	0.74%	17.47%	NA
Indica I	595	38.50%	61.00%	0.50%	0.00%	NA
Indica II	465	47.30%	43.00%	0.43%	9.25%	NA
Indica III	913	38.90%	60.80%	0.11%	0.22%	NA
Indica Intermediate	786	40.20%	53.40%	0.64%	5.73%	NA
Temperate Japonica	767	97.10%	2.60%	0.00%	0.26%	NA
Tropical Japonica	504	61.10%	38.90%	0.00%	0.00%	NA
Japonica Intermediate	241	65.60%	34.00%	0.00%	0.41%	NA
VI/Aromatic	96	42.70%	36.50%	0.00%	20.83%	NA
Intermediate	90	55.60%	37.80%	0.00%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124975706	C -> T	LOC_Os11g41620.1	upstream_gene_variant ; 442.0bp to feature; MODIFIER	silent_mutation	Average:60.798; most accessible tissue: Callus, score: 90.535	N	N	N	N
vg1124975706	C -> T	LOC_Os11g41610.1	downstream_gene_variant ; 656.0bp to feature; MODIFIER	silent_mutation	Average:60.798; most accessible tissue: Callus, score: 90.535	N	N	N	N
vg1124975706	C -> T	LOC_Os11g41630.1	downstream_gene_variant ; 4075.0bp to feature; MODIFIER	silent_mutation	Average:60.798; most accessible tissue: Callus, score: 90.535	N	N	N	N
vg1124975706	C -> T	LOC_Os11g41610-LOC_Os11g41620	intergenic_region ; MODIFIER	silent_mutation	Average:60.798; most accessible tissue: Callus, score: 90.535	N	N	N	N
vg1124975706	C -> DEL	N	N	silent_mutation	Average:60.798; most accessible tissue: Callus, score: 90.535	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124975706	NA	4.02E-08	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975706	NA	3.67E-08	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975706	9.44E-06	NA	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975706	4.19E-06	4.01E-11	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975706	1.18E-06	NA	mr1238_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975706	5.92E-06	5.92E-06	mr1579_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975706	2.13E-06	NA	mr1841_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975706	2.14E-06	NA	mr1900_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251