\
| Variant ID: vg1124938370 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24938370 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.58, G: 0.42, others allele: 0.00, population size: 45. )
GTCCGATGGTCATTGGGATTTTGTCTATCCTTCTATTCTTCAGAATAATTCGGATTAGTAAGCGAAGATATACGTTCGCCATGATATTATAGTATCATCA[A/G]
GAACAAGAGGAAGAAATCAATATCCTATTTTGGGAATTCAATCAAAATACCCTTTATATATGTATGAATCATAGGCTGGTGATGCTTACTTGCCTTACTC
GAGTAAGGCAAGTAAGCATCACCAGCCTATGATTCATACATATATAAAGGGTATTTTGATTGAATTCCCAAAATAGGATATTGATTTCTTCCTCTTGTTC[T/C]
TGATGATACTATAATATCATGGCGAACGTATATCTTCGCTTACTAATCCGAATTATTCTGAAGAATAGAAGGATAGACAAAATCCCAATGACCATCGGAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.90% | 41.00% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 49.30% | 50.60% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 80.00% | 20.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 33.80% | 66.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 58.30% | 41.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 54.20% | 45.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 38.00% | 62.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 52.80% | 47.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 94.30% | 5.60% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 67.50% | 32.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 60.60% | 39.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 68.80% | 31.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 34.40% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124938370 | A -> G | LOC_Os11g41560.1 | downstream_gene_variant ; 3149.0bp to feature; MODIFIER | silent_mutation | Average:33.411; most accessible tissue: Callus, score: 60.519 | N | N | N | N |
| vg1124938370 | A -> G | LOC_Os11g41580.1 | downstream_gene_variant ; 3096.0bp to feature; MODIFIER | silent_mutation | Average:33.411; most accessible tissue: Callus, score: 60.519 | N | N | N | N |
| vg1124938370 | A -> G | LOC_Os11g41570.1 | intron_variant ; MODIFIER | silent_mutation | Average:33.411; most accessible tissue: Callus, score: 60.519 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124938370 | 2.01E-08 | 2.92E-19 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124938370 | 1.30E-07 | 5.50E-13 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124938370 | 2.02E-08 | 3.69E-21 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124938370 | 8.87E-10 | 1.34E-17 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124938370 | 1.06E-13 | 1.47E-31 | mr1191_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124938370 | 1.52E-12 | 1.06E-22 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124938370 | 7.75E-06 | NA | mr1238_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |