\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124938370:

Variant ID: vg1124938370 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24938370
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.58, G: 0.42, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


GTCCGATGGTCATTGGGATTTTGTCTATCCTTCTATTCTTCAGAATAATTCGGATTAGTAAGCGAAGATATACGTTCGCCATGATATTATAGTATCATCA[A/G]
GAACAAGAGGAAGAAATCAATATCCTATTTTGGGAATTCAATCAAAATACCCTTTATATATGTATGAATCATAGGCTGGTGATGCTTACTTGCCTTACTC

Reverse complement sequence

GAGTAAGGCAAGTAAGCATCACCAGCCTATGATTCATACATATATAAAGGGTATTTTGATTGAATTCCCAAAATAGGATATTGATTTCTTCCTCTTGTTC[T/C]
TGATGATACTATAATATCATGGCGAACGTATATCTTCGCTTACTAATCCGAATTATTCTGAAGAATAGAAGGATAGACAAAATCCCAATGACCATCGGAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.90% 41.00% 0.08% 0.00% NA
All Indica  2759 49.30% 50.60% 0.04% 0.00% NA
All Japonica  1512 80.00% 20.00% 0.07% 0.00% NA
Aus  269 33.80% 66.20% 0.00% 0.00% NA
Indica I  595 58.30% 41.70% 0.00% 0.00% NA
Indica II  465 54.20% 45.80% 0.00% 0.00% NA
Indica III  913 38.00% 62.00% 0.00% 0.00% NA
Indica Intermediate  786 52.80% 47.10% 0.13% 0.00% NA
Temperate Japonica  767 94.30% 5.60% 0.13% 0.00% NA
Tropical Japonica  504 67.50% 32.50% 0.00% 0.00% NA
Japonica Intermediate  241 60.60% 39.40% 0.00% 0.00% NA
VI/Aromatic  96 68.80% 31.20% 0.00% 0.00% NA
Intermediate  90 63.30% 34.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124938370 A -> G LOC_Os11g41560.1 downstream_gene_variant ; 3149.0bp to feature; MODIFIER silent_mutation Average:33.411; most accessible tissue: Callus, score: 60.519 N N N N
vg1124938370 A -> G LOC_Os11g41580.1 downstream_gene_variant ; 3096.0bp to feature; MODIFIER silent_mutation Average:33.411; most accessible tissue: Callus, score: 60.519 N N N N
vg1124938370 A -> G LOC_Os11g41570.1 intron_variant ; MODIFIER silent_mutation Average:33.411; most accessible tissue: Callus, score: 60.519 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124938370 2.01E-08 2.92E-19 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124938370 1.30E-07 5.50E-13 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124938370 2.02E-08 3.69E-21 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124938370 8.87E-10 1.34E-17 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124938370 1.06E-13 1.47E-31 mr1191_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124938370 1.52E-12 1.06E-22 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124938370 7.75E-06 NA mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251