\
| Variant ID: vg1124918104 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24918104 |
| Reference Allele: G | Alternative Allele: T,A |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CAGAATGAACAGAGTTACGAAGTAAGAGTAGATTAGTTTTTTTTTTATGGAACCTGCCCATCCAAATTTAAGTATGGCTGATTAGGTTTTTCTTTTTATG[G/T,A]
AACCTGCCCATTCAAGTTTAAGTATGGCTAATTATTTTTTTAAGTAGTAGGCAACGTAGCTATTGCAGCAAGACATATATGGTGACTTTGTCAATCTTGA
TCAAGATTGACAAAGTCACCATATATGTCTTGCTGCAATAGCTACGTTGCCTACTACTTAAAAAAATAATTAGCCATACTTAAACTTGAATGGGCAGGTT[C/A,T]
CATAAAAAGAAAAACCTAATCAGCCATACTTAAATTTGGATGGGCAGGTTCCATAAAAAAAAAACTAATCTACTCTTACTTCGTAACTCTGTTCATTCTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.60% | 3.40% | 0.57% | 30.39% | A: 0.02% |
| All Indica | 2759 | 56.50% | 0.00% | 0.87% | 42.59% | A: 0.04% |
| All Japonica | 1512 | 75.00% | 10.40% | 0.07% | 14.48% | NA |
| Aus | 269 | 97.00% | 0.00% | 0.37% | 2.60% | NA |
| Indica I | 595 | 38.00% | 0.00% | 1.51% | 60.50% | NA |
| Indica II | 465 | 73.50% | 0.20% | 0.86% | 25.38% | NA |
| Indica III | 913 | 59.00% | 0.00% | 0.66% | 40.20% | A: 0.11% |
| Indica Intermediate | 786 | 57.40% | 0.00% | 0.64% | 41.98% | NA |
| Temperate Japonica | 767 | 90.20% | 4.80% | 0.00% | 4.95% | NA |
| Tropical Japonica | 504 | 53.20% | 19.80% | 0.00% | 26.98% | NA |
| Japonica Intermediate | 241 | 72.20% | 8.70% | 0.41% | 18.67% | NA |
| VI/Aromatic | 96 | 91.70% | 0.00% | 0.00% | 8.33% | NA |
| Intermediate | 90 | 65.60% | 3.30% | 1.11% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124918104 | G -> T | LOC_Os11g41540.1 | downstream_gene_variant ; 1054.0bp to feature; MODIFIER | silent_mutation | Average:33.901; most accessible tissue: Callus, score: 64.68 | N | N | N | N |
| vg1124918104 | G -> T | LOC_Os11g41540.2 | downstream_gene_variant ; 1060.0bp to feature; MODIFIER | silent_mutation | Average:33.901; most accessible tissue: Callus, score: 64.68 | N | N | N | N |
| vg1124918104 | G -> T | LOC_Os11g41540.3 | downstream_gene_variant ; 1060.0bp to feature; MODIFIER | silent_mutation | Average:33.901; most accessible tissue: Callus, score: 64.68 | N | N | N | N |
| vg1124918104 | G -> T | LOC_Os11g41540.4 | downstream_gene_variant ; 1060.0bp to feature; MODIFIER | silent_mutation | Average:33.901; most accessible tissue: Callus, score: 64.68 | N | N | N | N |
| vg1124918104 | G -> T | LOC_Os11g41540-LOC_Os11g41550 | intergenic_region ; MODIFIER | silent_mutation | Average:33.901; most accessible tissue: Callus, score: 64.68 | N | N | N | N |
| vg1124918104 | G -> A | LOC_Os11g41540.1 | downstream_gene_variant ; 1054.0bp to feature; MODIFIER | silent_mutation | Average:33.901; most accessible tissue: Callus, score: 64.68 | N | N | N | N |
| vg1124918104 | G -> A | LOC_Os11g41540.2 | downstream_gene_variant ; 1060.0bp to feature; MODIFIER | silent_mutation | Average:33.901; most accessible tissue: Callus, score: 64.68 | N | N | N | N |
| vg1124918104 | G -> A | LOC_Os11g41540.3 | downstream_gene_variant ; 1060.0bp to feature; MODIFIER | silent_mutation | Average:33.901; most accessible tissue: Callus, score: 64.68 | N | N | N | N |
| vg1124918104 | G -> A | LOC_Os11g41540.4 | downstream_gene_variant ; 1060.0bp to feature; MODIFIER | silent_mutation | Average:33.901; most accessible tissue: Callus, score: 64.68 | N | N | N | N |
| vg1124918104 | G -> A | LOC_Os11g41540-LOC_Os11g41550 | intergenic_region ; MODIFIER | silent_mutation | Average:33.901; most accessible tissue: Callus, score: 64.68 | N | N | N | N |
| vg1124918104 | G -> DEL | N | N | silent_mutation | Average:33.901; most accessible tissue: Callus, score: 64.68 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124918104 | 9.55E-08 | 1.67E-08 | mr1238 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124918104 | 4.30E-06 | 6.57E-07 | mr1484 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124918104 | NA | 4.37E-07 | mr1900 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124918104 | 8.68E-10 | 7.37E-11 | mr1238_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124918104 | 1.37E-08 | 1.37E-08 | mr1484_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124918104 | 3.97E-06 | 3.97E-06 | mr1609_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124918104 | 6.33E-07 | 4.52E-08 | mr1841_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124918104 | 7.57E-07 | 1.02E-07 | mr1900_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124918104 | 6.94E-10 | 6.94E-10 | mr1945_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |