\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124918104:

Variant ID: vg1124918104 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24918104
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGAATGAACAGAGTTACGAAGTAAGAGTAGATTAGTTTTTTTTTTATGGAACCTGCCCATCCAAATTTAAGTATGGCTGATTAGGTTTTTCTTTTTATG[G/T,A]
AACCTGCCCATTCAAGTTTAAGTATGGCTAATTATTTTTTTAAGTAGTAGGCAACGTAGCTATTGCAGCAAGACATATATGGTGACTTTGTCAATCTTGA

Reverse complement sequence

TCAAGATTGACAAAGTCACCATATATGTCTTGCTGCAATAGCTACGTTGCCTACTACTTAAAAAAATAATTAGCCATACTTAAACTTGAATGGGCAGGTT[C/A,T]
CATAAAAAGAAAAACCTAATCAGCCATACTTAAATTTGGATGGGCAGGTTCCATAAAAAAAAAACTAATCTACTCTTACTTCGTAACTCTGTTCATTCTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.60% 3.40% 0.57% 30.39% A: 0.02%
All Indica  2759 56.50% 0.00% 0.87% 42.59% A: 0.04%
All Japonica  1512 75.00% 10.40% 0.07% 14.48% NA
Aus  269 97.00% 0.00% 0.37% 2.60% NA
Indica I  595 38.00% 0.00% 1.51% 60.50% NA
Indica II  465 73.50% 0.20% 0.86% 25.38% NA
Indica III  913 59.00% 0.00% 0.66% 40.20% A: 0.11%
Indica Intermediate  786 57.40% 0.00% 0.64% 41.98% NA
Temperate Japonica  767 90.20% 4.80% 0.00% 4.95% NA
Tropical Japonica  504 53.20% 19.80% 0.00% 26.98% NA
Japonica Intermediate  241 72.20% 8.70% 0.41% 18.67% NA
VI/Aromatic  96 91.70% 0.00% 0.00% 8.33% NA
Intermediate  90 65.60% 3.30% 1.11% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124918104 G -> T LOC_Os11g41540.1 downstream_gene_variant ; 1054.0bp to feature; MODIFIER silent_mutation Average:33.901; most accessible tissue: Callus, score: 64.68 N N N N
vg1124918104 G -> T LOC_Os11g41540.2 downstream_gene_variant ; 1060.0bp to feature; MODIFIER silent_mutation Average:33.901; most accessible tissue: Callus, score: 64.68 N N N N
vg1124918104 G -> T LOC_Os11g41540.3 downstream_gene_variant ; 1060.0bp to feature; MODIFIER silent_mutation Average:33.901; most accessible tissue: Callus, score: 64.68 N N N N
vg1124918104 G -> T LOC_Os11g41540.4 downstream_gene_variant ; 1060.0bp to feature; MODIFIER silent_mutation Average:33.901; most accessible tissue: Callus, score: 64.68 N N N N
vg1124918104 G -> T LOC_Os11g41540-LOC_Os11g41550 intergenic_region ; MODIFIER silent_mutation Average:33.901; most accessible tissue: Callus, score: 64.68 N N N N
vg1124918104 G -> A LOC_Os11g41540.1 downstream_gene_variant ; 1054.0bp to feature; MODIFIER silent_mutation Average:33.901; most accessible tissue: Callus, score: 64.68 N N N N
vg1124918104 G -> A LOC_Os11g41540.2 downstream_gene_variant ; 1060.0bp to feature; MODIFIER silent_mutation Average:33.901; most accessible tissue: Callus, score: 64.68 N N N N
vg1124918104 G -> A LOC_Os11g41540.3 downstream_gene_variant ; 1060.0bp to feature; MODIFIER silent_mutation Average:33.901; most accessible tissue: Callus, score: 64.68 N N N N
vg1124918104 G -> A LOC_Os11g41540.4 downstream_gene_variant ; 1060.0bp to feature; MODIFIER silent_mutation Average:33.901; most accessible tissue: Callus, score: 64.68 N N N N
vg1124918104 G -> A LOC_Os11g41540-LOC_Os11g41550 intergenic_region ; MODIFIER silent_mutation Average:33.901; most accessible tissue: Callus, score: 64.68 N N N N
vg1124918104 G -> DEL N N silent_mutation Average:33.901; most accessible tissue: Callus, score: 64.68 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124918104 9.55E-08 1.67E-08 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124918104 4.30E-06 6.57E-07 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124918104 NA 4.37E-07 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124918104 8.68E-10 7.37E-11 mr1238_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124918104 1.37E-08 1.37E-08 mr1484_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124918104 3.97E-06 3.97E-06 mr1609_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124918104 6.33E-07 4.52E-08 mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124918104 7.57E-07 1.02E-07 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124918104 6.94E-10 6.94E-10 mr1945_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251