\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124914537:

Variant ID: vg1124914537 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24914537
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:


ACAAAAGGTCTTCACTACAAGATGTTAATGAGTTTGAAGAACTAGGGAGAAAGCTTGCTAGAAAATGCAACGGATTGCCTCTTGCACTTGCAGTTCTGGG[G/T]
GGTTATCTGTCCAAAAATCTAAACATACAAGCATGGTCAGACATATTTAAGAGCCGGATATCAACAAAAAATGGACAGATGATGCGAGACATACTAGCTC

Reverse complement sequence

GAGCTAGTATGTCTCGCATCATCTGTCCATTTTTTGTTGATATCCGGCTCTTAAATATGTCTGACCATGCTTGTATGTTTAGATTTTTGGACAGATAACC[C/A]
CCCAGAACTGCAAGTGCAAGAGGCAATCCGTTGCATTTTCTAGCAAGCTTTCTCCCTAGTTCTTCAAACTCATTAACATCTTGTAGTGAAGACCTTTTGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.30% 2.80% 0.87% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 88.80% 8.70% 2.51% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 79.50% 15.80% 4.69% 0.00% NA
Tropical Japonica  504 99.00% 0.80% 0.20% 0.00% NA
Japonica Intermediate  241 97.10% 2.50% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 0.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124914537 G -> T LOC_Os11g41540.1 synonymous_variant ; p.Gly383Gly; LOW synonymous_codon Average:35.787; most accessible tissue: Callus, score: 78.906 N N N N
vg1124914537 G -> T LOC_Os11g41540.2 synonymous_variant ; p.Gly383Gly; LOW synonymous_codon Average:35.787; most accessible tissue: Callus, score: 78.906 N N N N
vg1124914537 G -> T LOC_Os11g41540.3 synonymous_variant ; p.Gly383Gly; LOW synonymous_codon Average:35.787; most accessible tissue: Callus, score: 78.906 N N N N
vg1124914537 G -> T LOC_Os11g41540.4 synonymous_variant ; p.Gly356Gly; LOW synonymous_codon Average:35.787; most accessible tissue: Callus, score: 78.906 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124914537 NA 4.10E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124914537 7.30E-11 1.12E-06 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124914537 1.17E-06 NA mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124914537 7.07E-14 2.74E-07 mr1309 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124914537 1.74E-07 NA mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124914537 4.90E-10 2.90E-07 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124914537 4.55E-12 8.80E-08 mr1841 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124914537 9.58E-13 9.18E-06 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124914537 3.32E-08 NA mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124914537 7.76E-13 2.09E-08 mr1238_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124914537 1.23E-07 NA mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124914537 3.42E-09 3.43E-09 mr1484_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124914537 1.93E-14 6.98E-09 mr1841_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124914537 7.01E-13 3.77E-08 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124914537 4.35E-09 4.35E-09 mr1945_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124914537 3.47E-07 NA mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251