\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124898439:

Variant ID: vg1124898439 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24898439
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.08, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGTTAAGGGACCTCAGATGAACTTATTCCTCCCCGCTATAACCTTCAGGATGAAGCACACCAACAGCCTCCCCATCCACTAAAGTTCAAACAGTAACA[G/A]
TGCTCAAACAGTAATCCAATTTACTGTTGGATGCTTTTTACTGTAGCGTGATACTGTAGCAGGCTGATCTGTGCCGTTCGATAGAGATCCAATGGCTCAA

Reverse complement sequence

TTGAGCCATTGGATCTCTATCGAACGGCACAGATCAGCCTGCTACAGTATCACGCTACAGTAAAAAGCATCCAACAGTAAATTGGATTACTGTTTGAGCA[C/T]
TGTTACTGTTTGAACTTTAGTGGATGGGGAGGCTGTTGGTGTGCTTCATCCTGAAGGTTATAGCGGGGAGGAATAAGTTCATCTGAGGTCCCTTAACTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.10% 15.20% 0.34% 0.38% NA
All Indica  2759 97.70% 2.20% 0.04% 0.00% NA
All Japonica  1512 63.50% 34.50% 0.86% 1.19% NA
Aus  269 76.20% 23.40% 0.37% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.50% 1.30% 0.22% 0.00% NA
Indica III  913 96.40% 3.60% 0.00% 0.00% NA
Indica Intermediate  786 97.20% 2.80% 0.00% 0.00% NA
Temperate Japonica  767 87.40% 11.60% 0.52% 0.52% NA
Tropical Japonica  504 36.10% 59.70% 1.59% 2.58% NA
Japonica Intermediate  241 44.80% 54.40% 0.41% 0.41% NA
VI/Aromatic  96 40.60% 59.40% 0.00% 0.00% NA
Intermediate  90 84.40% 14.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124898439 G -> A LOC_Os11g41500.1 upstream_gene_variant ; 4941.0bp to feature; MODIFIER silent_mutation Average:87.545; most accessible tissue: Minghui63 panicle, score: 98.639 N N N N
vg1124898439 G -> A LOC_Os11g41520.1 upstream_gene_variant ; 1528.0bp to feature; MODIFIER silent_mutation Average:87.545; most accessible tissue: Minghui63 panicle, score: 98.639 N N N N
vg1124898439 G -> A LOC_Os11g41510.1 downstream_gene_variant ; 162.0bp to feature; MODIFIER silent_mutation Average:87.545; most accessible tissue: Minghui63 panicle, score: 98.639 N N N N
vg1124898439 G -> A LOC_Os11g41500-LOC_Os11g41510 intergenic_region ; MODIFIER silent_mutation Average:87.545; most accessible tissue: Minghui63 panicle, score: 98.639 N N N N
vg1124898439 G -> DEL N N silent_mutation Average:87.545; most accessible tissue: Minghui63 panicle, score: 98.639 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1124898439 G A -0.12 -0.13 -0.1 -0.14 -0.12 -0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124898439 NA 1.22E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124898439 NA 2.18E-12 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124898439 NA 3.45E-06 mr1195_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124898439 2.63E-06 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124898439 NA 1.72E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124898439 NA 2.44E-11 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124898439 NA 7.14E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124898439 NA 4.52E-07 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124898439 2.97E-07 NA mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124898439 4.79E-06 4.79E-06 mr1609_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124898439 NA 2.61E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124898439 2.92E-06 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124898439 9.60E-08 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124898439 1.98E-06 9.95E-07 mr1925_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124898439 NA 1.94E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124898439 NA 2.96E-07 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251