\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124875808:

Variant ID: vg1124875808 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24875808
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, T: 0.14, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


TGAAAGTAGTGGCGTAGCTTTCTTGATGTCATAATTACTGCATAAAGTAGCTTTTGGATCTATGGGTATCTTGTCTACGCGTCGTGGAGAGCTTCGCTGA[C/T]
GTAGTAAACCGGTCTTTGCACCTTCTCTCTCTCGACAATAATGACAGTACTCACAGAGTATGGCGAGGCAGCGATATAGAGGAATAATTCTTCATTAAGT

Reverse complement sequence

ACTTAATGAAGAATTATTCCTCTATATCGCTGCCTCGCCATACTCTGTGAGTACTGTCATTATTGTCGAGAGAGAGAAGGTGCAAAGACCGGTTTACTAC[G/A]
TCAGCGAAGCTCTCCACGACGCGTAGACAAGATACCCATAGATCCAAAAGCTACTTTATGCAGTAATTATGACATCAAGAAAGCTACGCCACTACTTTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.10% 18.90% 1.14% 0.85% NA
All Indica  2759 97.20% 2.60% 0.11% 0.04% NA
All Japonica  1512 52.80% 44.20% 2.98% 0.00% NA
Aus  269 53.20% 30.50% 2.23% 14.13% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 95.40% 4.50% 0.11% 0.00% NA
Indica Intermediate  786 96.40% 3.20% 0.25% 0.13% NA
Temperate Japonica  767 68.70% 25.60% 5.74% 0.00% NA
Tropical Japonica  504 33.70% 66.30% 0.00% 0.00% NA
Japonica Intermediate  241 42.30% 57.30% 0.41% 0.00% NA
VI/Aromatic  96 41.70% 58.30% 0.00% 0.00% NA
Intermediate  90 83.30% 15.60% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124875808 C -> T LOC_Os11g41480.1 upstream_gene_variant ; 4046.0bp to feature; MODIFIER silent_mutation Average:42.003; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N
vg1124875808 C -> T LOC_Os11g41460.1 downstream_gene_variant ; 2663.0bp to feature; MODIFIER silent_mutation Average:42.003; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N
vg1124875808 C -> T LOC_Os11g41470.1 intron_variant ; MODIFIER silent_mutation Average:42.003; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N
vg1124875808 C -> DEL N N silent_mutation Average:42.003; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124875808 6.36E-15 1.18E-27 mr1238 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 5.25E-11 9.69E-11 mr1238 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 NA 5.20E-06 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 3.38E-14 7.76E-27 mr1309 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 3.56E-11 4.20E-09 mr1309 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 1.96E-06 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 NA 2.65E-07 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 1.50E-09 3.85E-17 mr1484 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 1.06E-07 2.51E-06 mr1484 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 1.16E-07 2.02E-17 mr1566 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 8.52E-12 1.75E-19 mr1609 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 9.20E-11 9.20E-11 mr1609 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 9.33E-16 4.17E-28 mr1841 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 9.27E-11 3.12E-08 mr1841 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 5.16E-13 1.32E-17 mr1900 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 4.56E-10 4.85E-09 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 NA 1.50E-06 mr1195_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 2.82E-18 7.88E-30 mr1238_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 6.00E-14 5.47E-12 mr1238_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 3.07E-06 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 NA 5.06E-08 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 2.95E-17 7.46E-29 mr1484_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 2.94E-11 2.94E-11 mr1484_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 2.30E-14 4.90E-28 mr1609_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 4.91E-13 4.91E-13 mr1609_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 1.05E-19 1.88E-35 mr1841_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 1.74E-15 9.69E-13 mr1841_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 6.59E-21 5.08E-25 mr1900_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 4.17E-15 2.51E-13 mr1900_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 7.27E-09 2.25E-09 mr1925_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 4.38E-07 4.38E-07 mr1925_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 5.74E-13 1.55E-21 mr1945_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 6.64E-10 6.64E-10 mr1945_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 1.05E-06 NA mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124875808 2.33E-07 6.00E-09 mr1959_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251