Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124857333:

Variant ID: vg1124857333 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24857333
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATGTCTGCGGGCATCATAGACTAGGCTTCCCGAGTGGAAGCAGATTGTTGTGCTGCGGGACAGCGGGACTCTTTGAGTCTGAGAAAATGAAAAAGGCTC[A/G]
GGTATCCAATTAATAAGTGAAATGGCTCTATGAGCTGAGAAGCAATGATCCGACCTGGGAAGTCAGTGCACTACCAGTTGAGTTGTTGAAAAGCATCTAT

Reverse complement sequence

ATAGATGCTTTTCAACAACTCAACTGGTAGTGCACTGACTTCCCAGGTCGGATCATTGCTTCTCAGCTCATAGAGCCATTTCACTTATTAATTGGATACC[T/C]
GAGCCTTTTTCATTTTCTCAGACTCAAAGAGTCCCGCTGTCCCGCAGCACAACAATCTGCTTCCACTCGGGAAGCCTAGTCTATGATGCCCGCAGACATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.80%	6.10%	1.44%	16.61%	NA
All Indica	2759	97.10%	0.40%	0.11%	2.43%	NA
All Japonica	1512	43.10%	17.70%	3.57%	35.71%	NA
Aus	269	55.00%	0.40%	0.00%	44.61%	NA
Indica I	595	99.80%	0.00%	0.00%	0.17%	NA
Indica II	465	97.40%	1.30%	0.00%	1.29%	NA
Indica III	913	95.60%	0.10%	0.22%	4.05%	NA
Indica Intermediate	786	96.60%	0.40%	0.13%	2.93%	NA
Temperate Japonica	767	49.90%	31.60%	6.65%	11.86%	NA
Tropical Japonica	504	34.90%	1.00%	0.40%	63.69%	NA
Japonica Intermediate	241	38.20%	8.30%	0.41%	53.11%	NA
VI/Aromatic	96	43.80%	3.10%	7.29%	45.83%	NA
Intermediate	90	71.10%	8.90%	4.44%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124857333	A -> DEL	N	N	silent_mutation	Average:36.985; most accessible tissue: Zhenshan97 young leaf, score: 80.325	N	N	N	N
vg1124857333	A -> G	LOC_Os11g41410.1	upstream_gene_variant ; 3362.0bp to feature; MODIFIER	silent_mutation	Average:36.985; most accessible tissue: Zhenshan97 young leaf, score: 80.325	N	N	N	N
vg1124857333	A -> G	LOC_Os11g41430.1	upstream_gene_variant ; 2821.0bp to feature; MODIFIER	silent_mutation	Average:36.985; most accessible tissue: Zhenshan97 young leaf, score: 80.325	N	N	N	N
vg1124857333	A -> G	LOC_Os11g41420.1	downstream_gene_variant ; 1063.0bp to feature; MODIFIER	silent_mutation	Average:36.985; most accessible tissue: Zhenshan97 young leaf, score: 80.325	N	N	N	N
vg1124857333	A -> G	LOC_Os11g41420-LOC_Os11g41430	intergenic_region ; MODIFIER	silent_mutation	Average:36.985; most accessible tissue: Zhenshan97 young leaf, score: 80.325	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124857333	1.64E-08	NA	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333	1.71E-06	1.70E-06	mr1238	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333	1.29E-10	NA	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333	1.05E-07	2.49E-07	mr1309	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333	4.91E-06	NA	mr1609	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333	8.27E-06	8.27E-06	mr1609	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333	5.04E-08	NA	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333	6.35E-06	NA	mr1841	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333	1.28E-07	NA	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333	4.72E-07	2.76E-07	mr1900	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333	8.80E-09	NA	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333	3.12E-07	NA	mr1238_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333	4.54E-06	NA	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333	5.28E-08	NA	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333	7.93E-11	NA	mr1609_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333	1.17E-09	1.17E-09	mr1609_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333	1.62E-10	NA	mr1841_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333	2.80E-08	8.66E-06	mr1841_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333	1.75E-09	NA	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333	6.43E-08	2.27E-06	mr1900_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333	3.62E-06	NA	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333	1.60E-06	NA	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251