\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124857333:

Variant ID: vg1124857333 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24857333
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATGTCTGCGGGCATCATAGACTAGGCTTCCCGAGTGGAAGCAGATTGTTGTGCTGCGGGACAGCGGGACTCTTTGAGTCTGAGAAAATGAAAAAGGCTC[A/G]
GGTATCCAATTAATAAGTGAAATGGCTCTATGAGCTGAGAAGCAATGATCCGACCTGGGAAGTCAGTGCACTACCAGTTGAGTTGTTGAAAAGCATCTAT

Reverse complement sequence

ATAGATGCTTTTCAACAACTCAACTGGTAGTGCACTGACTTCCCAGGTCGGATCATTGCTTCTCAGCTCATAGAGCCATTTCACTTATTAATTGGATACC[T/C]
GAGCCTTTTTCATTTTCTCAGACTCAAAGAGTCCCGCTGTCCCGCAGCACAACAATCTGCTTCCACTCGGGAAGCCTAGTCTATGATGCCCGCAGACATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.80% 6.10% 1.44% 16.61% NA
All Indica  2759 97.10% 0.40% 0.11% 2.43% NA
All Japonica  1512 43.10% 17.70% 3.57% 35.71% NA
Aus  269 55.00% 0.40% 0.00% 44.61% NA
Indica I  595 99.80% 0.00% 0.00% 0.17% NA
Indica II  465 97.40% 1.30% 0.00% 1.29% NA
Indica III  913 95.60% 0.10% 0.22% 4.05% NA
Indica Intermediate  786 96.60% 0.40% 0.13% 2.93% NA
Temperate Japonica  767 49.90% 31.60% 6.65% 11.86% NA
Tropical Japonica  504 34.90% 1.00% 0.40% 63.69% NA
Japonica Intermediate  241 38.20% 8.30% 0.41% 53.11% NA
VI/Aromatic  96 43.80% 3.10% 7.29% 45.83% NA
Intermediate  90 71.10% 8.90% 4.44% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124857333 A -> DEL N N silent_mutation Average:36.985; most accessible tissue: Zhenshan97 young leaf, score: 80.325 N N N N
vg1124857333 A -> G LOC_Os11g41410.1 upstream_gene_variant ; 3362.0bp to feature; MODIFIER silent_mutation Average:36.985; most accessible tissue: Zhenshan97 young leaf, score: 80.325 N N N N
vg1124857333 A -> G LOC_Os11g41430.1 upstream_gene_variant ; 2821.0bp to feature; MODIFIER silent_mutation Average:36.985; most accessible tissue: Zhenshan97 young leaf, score: 80.325 N N N N
vg1124857333 A -> G LOC_Os11g41420.1 downstream_gene_variant ; 1063.0bp to feature; MODIFIER silent_mutation Average:36.985; most accessible tissue: Zhenshan97 young leaf, score: 80.325 N N N N
vg1124857333 A -> G LOC_Os11g41420-LOC_Os11g41430 intergenic_region ; MODIFIER silent_mutation Average:36.985; most accessible tissue: Zhenshan97 young leaf, score: 80.325 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124857333 1.64E-08 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333 1.71E-06 1.70E-06 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333 1.29E-10 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333 1.05E-07 2.49E-07 mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333 4.91E-06 NA mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333 8.27E-06 8.27E-06 mr1609 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333 5.04E-08 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333 6.35E-06 NA mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333 1.28E-07 NA mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333 4.72E-07 2.76E-07 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333 8.80E-09 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333 3.12E-07 NA mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333 4.54E-06 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333 5.28E-08 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333 7.93E-11 NA mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333 1.17E-09 1.17E-09 mr1609_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333 1.62E-10 NA mr1841_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333 2.80E-08 8.66E-06 mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333 1.75E-09 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333 6.43E-08 2.27E-06 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333 3.62E-06 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124857333 1.60E-06 NA mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251