\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124705653:

Variant ID: vg1124705653 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24705653
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTTTAGCTCGCAACTCAGTATAAAAATAAAAAGAGTAAATTTCACAATATTATATCTATATATCTATCATATACTCTCTCCGTCGCAGAATATAACAA[C/T]
CTAGGATATAACAACCTAGAATGGGATGAGACCCATGCTAGGACAATGTATATGGACATGAGCTAGGATGGGTCTCATCCTATCCTAGGTTATTACATTC

Reverse complement sequence

GAATGTAATAACCTAGGATAGGATGAGACCCATCCTAGCTCATGTCCATATACATTGTCCTAGCATGGGTCTCATCCCATTCTAGGTTGTTATATCCTAG[G/A]
TTGTTATATTCTGCGACGGAGAGAGTATATGATAGATATATAGATATAATATTGTGAAATTTACTCTTTTTATTTTTATACTGAGTTGCGAGCTAAAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.20% 0.10% 8.51% 42.17% NA
All Indica  2759 23.30% 0.20% 12.72% 63.72% NA
All Japonica  1512 84.50% 0.00% 2.91% 12.57% NA
Aus  269 97.00% 0.00% 0.00% 2.97% NA
Indica I  595 13.60% 0.20% 16.47% 69.75% NA
Indica II  465 18.70% 0.00% 15.48% 65.81% NA
Indica III  913 31.50% 0.10% 7.89% 60.46% NA
Indica Intermediate  786 23.90% 0.50% 13.87% 61.70% NA
Temperate Japonica  767 74.10% 0.00% 5.22% 20.73% NA
Tropical Japonica  504 95.80% 0.00% 0.79% 3.37% NA
Japonica Intermediate  241 94.20% 0.00% 0.00% 5.81% NA
VI/Aromatic  96 93.80% 0.00% 0.00% 6.25% NA
Intermediate  90 56.70% 1.10% 7.78% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124705653 C -> T LOC_Os11g41190-LOC_Os11g41210 intergenic_region ; MODIFIER silent_mutation Average:27.866; most accessible tissue: Callus, score: 35.93 N N N N
vg1124705653 C -> DEL N N silent_mutation Average:27.866; most accessible tissue: Callus, score: 35.93 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124705653 NA 6.36E-06 mr1245_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124705653 1.19E-06 1.19E-06 mr1329_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124705653 9.98E-08 9.98E-08 mr1337_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124705653 9.57E-06 2.77E-06 mr1373_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124705653 7.03E-06 3.59E-06 mr1397_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124705653 1.79E-07 1.79E-07 mr1524_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124705653 4.49E-06 4.49E-06 mr1674_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124705653 6.37E-06 6.37E-06 mr1688_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124705653 2.93E-07 2.93E-07 mr1760_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124705653 8.63E-06 8.63E-06 mr1982_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251