\
| Variant ID: vg1124477987 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24477987 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCCTAGAATCTTCGCCACTGCATTAGTGCTCTTCCACGGCACCGGCTCCGGTGGCACCTCCTGGCCGCCAGCGCCGCCGCAGCATTGGGCGTTCTTCCAC[C/A]
CTATTCCTTGATCCGTCGTCGCCGTCGATTAACTGCTAATTACTCTGAGCGGTGCCGACCAACATGGAGGGATGAAGCCGTAAATCTATGTATCGTCAGA
TCTGACGATACATAGATTTACGGCTTCATCCCTCCATGTTGGTCGGCACCGCTCAGAGTAATTAGCAGTTAATCGACGGCGACGACGGATCAAGGAATAG[G/T]
GTGGAAGAACGCCCAATGCTGCGGCGGCGCTGGCGGCCAGGAGGTGCCACCGGAGCCGGTGCCGTGGAAGAGCACTAATGCAGTGGCGAAGATTCTAGGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.60% | 2.50% | 8.44% | 55.44% | NA |
| All Indica | 2759 | 39.30% | 0.00% | 10.15% | 50.49% | NA |
| All Japonica | 1512 | 21.90% | 7.30% | 3.44% | 67.33% | NA |
| Aus | 269 | 42.40% | 0.40% | 19.70% | 37.55% | NA |
| Indica I | 595 | 31.30% | 0.00% | 15.29% | 53.45% | NA |
| Indica II | 465 | 24.10% | 0.00% | 7.31% | 68.60% | NA |
| Indica III | 913 | 49.30% | 0.00% | 9.31% | 41.40% | NA |
| Indica Intermediate | 786 | 42.90% | 0.10% | 8.91% | 48.09% | NA |
| Temperate Japonica | 767 | 32.30% | 0.00% | 1.96% | 65.71% | NA |
| Tropical Japonica | 504 | 10.10% | 20.80% | 4.37% | 64.68% | NA |
| Japonica Intermediate | 241 | 13.30% | 2.50% | 6.22% | 78.01% | NA |
| VI/Aromatic | 96 | 29.20% | 2.10% | 6.25% | 62.50% | NA |
| Intermediate | 90 | 34.40% | 3.30% | 8.89% | 53.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124477987 | C -> A | LOC_Os11g40890.1 | intron_variant ; MODIFIER | silent_mutation | Average:4.476; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1124477987 | C -> DEL | N | N | silent_mutation | Average:4.476; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124477987 | NA | 9.78E-06 | mr1039 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124477987 | NA | 5.55E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124477987 | 2.17E-06 | 2.17E-06 | mr1266 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124477987 | NA | 1.14E-06 | mr1345 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124477987 | NA | 1.16E-06 | mr1427 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124477987 | NA | 4.75E-06 | mr1560 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124477987 | NA | 1.27E-06 | mr1700 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124477987 | 8.73E-06 | 9.51E-06 | mr1707 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124477987 | 1.28E-07 | 5.83E-10 | mr1852 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |