\
| Variant ID: vg1124416534 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24416534 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.84, C: 0.16, others allele: 0.00, population size: 182. )
ACCTAAAGGAGTTATTATATTATAAAAGTATTATTCAACACGGCACTATCACAGAACAGCTTATCAGTGCCGGTTCAAGATAACTCGATACTGATGATGG[T/C]
TTTCCGTCCCAAAATACAAGCTTGCGCCATGCATATGTTCTCTTGGCACTGATGGGGAGATATCAGTACCGGGTCTTACAACCATTCGGCACTAATTGTT
AACAATTAGTGCCGAATGGTTGTAAGACCCGGTACTGATATCTCCCCATCAGTGCCAAGAGAACATATGCATGGCGCAAGCTTGTATTTTGGGACGGAAA[A/G]
CCATCATCAGTATCGAGTTATCTTGAACCGGCACTGATAAGCTGTTCTGTGATAGTGCCGTGTTGAATAATACTTTTATAATATAATAACTCCTTTAGGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.30% | 34.40% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 59.80% | 39.80% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 81.00% | 19.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 50.60% | 49.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 74.50% | 25.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 54.00% | 45.60% | 0.43% | 0.00% | NA |
| Indica III | 913 | 56.80% | 43.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 55.70% | 43.50% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 80.40% | 19.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 80.60% | 19.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 83.40% | 16.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 13.50% | 86.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 27.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124416534 | T -> C | LOC_Os11g40800.1 | downstream_gene_variant ; 737.0bp to feature; MODIFIER | silent_mutation | Average:56.87; most accessible tissue: Callus, score: 80.009 | N | N | N | N |
| vg1124416534 | T -> C | LOC_Os11g40800-LOC_Os11g40810 | intergenic_region ; MODIFIER | silent_mutation | Average:56.87; most accessible tissue: Callus, score: 80.009 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124416534 | NA | 3.75E-06 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124416534 | 3.12E-06 | NA | mr1771 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124416534 | NA | 9.51E-06 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124416534 | NA | 4.50E-08 | mr1609_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124416534 | NA | 5.59E-06 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124416534 | NA | 7.96E-06 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |