\
| Variant ID: vg1124348003 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24348003 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, G: 0.03, others allele: 0.00, population size: 103. )
TAGATGTAGCGATGAATATTGCATTATCTCTCGAGGCTTAAATATGAACATAAGTTGAAATTATACAGCCGGATTGATCCAAAAATTAAGCTAAACGTAA[C/G]
TGAACAACATTTGTCAATAACTTCACCAAAATCAGATAAATTTTATATCAAAAATCAGACAAACTGAGAATAATATTTACCCAAAACTTCATCAAAACCG
CGGTTTTGATGAAGTTTTGGGTAAATATTATTCTCAGTTTGTCTGATTTTTGATATAAAATTTATCTGATTTTGGTGAAGTTATTGACAAATGTTGTTCA[G/C]
TTACGTTTAGCTTAATTTTTGGATCAATCCGGCTGTATAATTTCAACTTATGTTCATATTTAAGCCTCGAGAGATAATGCAATATTCATCGCTACATCTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.40% | 12.90% | 0.15% | 1.46% | NA |
| All Indica | 2759 | 84.60% | 15.00% | 0.07% | 0.40% | NA |
| All Japonica | 1512 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 16.70% | 59.90% | 1.86% | 21.56% | NA |
| Indica I | 595 | 91.30% | 8.60% | 0.17% | 0.00% | NA |
| Indica II | 465 | 87.50% | 12.30% | 0.22% | 0.00% | NA |
| Indica III | 913 | 77.20% | 22.00% | 0.00% | 0.77% | NA |
| Indica Intermediate | 786 | 86.30% | 13.20% | 0.00% | 0.51% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 82.30% | 17.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124348003 | C -> DEL | N | N | silent_mutation | Average:28.781; most accessible tissue: Callus, score: 61.954 | N | N | N | N |
| vg1124348003 | C -> G | LOC_Os11g40700-LOC_Os11g40720 | intergenic_region ; MODIFIER | silent_mutation | Average:28.781; most accessible tissue: Callus, score: 61.954 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124348003 | 1.18E-10 | 8.06E-12 | mr1238 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124348003 | 1.54E-07 | 2.78E-08 | mr1309 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124348003 | 2.89E-07 | 2.84E-08 | mr1484 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124348003 | NA | 1.15E-06 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124348003 | NA | 1.79E-06 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124348003 | 3.76E-06 | 3.76E-06 | mr1900 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124348003 | 2.69E-07 | 6.20E-09 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124348003 | 5.43E-08 | 1.11E-09 | mr1484_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124348003 | NA | 1.73E-06 | mr1522_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124348003 | 1.80E-09 | 2.70E-12 | mr1841_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124348003 | NA | 7.50E-06 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124348003 | 1.67E-08 | 1.67E-08 | mr1945_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |