Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1124256871:

Variant ID: vg1124256871 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24256871
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTCCTTTTGTTTTCAATAACACACATACAGGAAAAAAAGGGGCATTGCTCGACGTATTTTAAAAAAAAATCCATATAGAACTTCTCCAAATAAGAGCC[C/T]
TCACTACGGTGCTCTCTGCTGGAAATAGAAAGAAATCCGAACTGTTGATCTCATTTGATCGAAGGGTTTAAATCTATTTGTACTACCACTCTAGTTAGCG

Reverse complement sequence

CGCTAACTAGAGTGGTAGTACAAATAGATTTAAACCCTTCGATCAAATGAGATCAACAGTTCGGATTTCTTTCTATTTCCAGCAGAGAGCACCGTAGTGA[G/A]
GGCTCTTATTTGGAGAAGTTCTATATGGATTTTTTTTTAAAATACGTCGAGCAATGCCCCTTTTTTTCCTGTATGTGTGTTATTGAAAACAAAAGGAAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.20%	5.80%	0.00%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	82.80%	17.20%	0.00%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	89.80%	10.20%	0.00%	0.00%	NA
Tropical Japonica	504	68.50%	31.50%	0.00%	0.00%	NA
Japonica Intermediate	241	90.50%	9.50%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124256871	C -> T	LOC_Os11g40640.1	upstream_gene_variant ; 1297.0bp to feature; MODIFIER	silent_mutation	Average:34.057; most accessible tissue: Zhenshan97 young leaf, score: 48.658	N	N	N	N
vg1124256871	C -> T	LOC_Os11g40630.1	downstream_gene_variant ; 4426.0bp to feature; MODIFIER	silent_mutation	Average:34.057; most accessible tissue: Zhenshan97 young leaf, score: 48.658	N	N	N	N
vg1124256871	C -> T	LOC_Os11g40650.1	downstream_gene_variant ; 2819.0bp to feature; MODIFIER	silent_mutation	Average:34.057; most accessible tissue: Zhenshan97 young leaf, score: 48.658	N	N	N	N
vg1124256871	C -> T	LOC_Os11g40640-LOC_Os11g40650	intergenic_region ; MODIFIER	silent_mutation	Average:34.057; most accessible tissue: Zhenshan97 young leaf, score: 48.658	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124256871	1.01E-09	NA	mr1238	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124256871	NA	3.59E-06	mr1238	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124256871	3.52E-06	NA	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124256871	9.80E-11	1.44E-18	mr1484	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124256871	4.28E-06	1.18E-06	mr1484	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124256871	9.84E-10	NA	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124256871	NA	4.58E-06	mr1238_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124256871	3.26E-09	NA	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124256871	NA	6.78E-06	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124256871	3.48E-08	NA	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124256871	9.01E-06	NA	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124256871	6.33E-08	NA	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251