\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124256871:

Variant ID: vg1124256871 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24256871
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTCCTTTTGTTTTCAATAACACACATACAGGAAAAAAAGGGGCATTGCTCGACGTATTTTAAAAAAAAATCCATATAGAACTTCTCCAAATAAGAGCC[C/T]
TCACTACGGTGCTCTCTGCTGGAAATAGAAAGAAATCCGAACTGTTGATCTCATTTGATCGAAGGGTTTAAATCTATTTGTACTACCACTCTAGTTAGCG

Reverse complement sequence

CGCTAACTAGAGTGGTAGTACAAATAGATTTAAACCCTTCGATCAAATGAGATCAACAGTTCGGATTTCTTTCTATTTCCAGCAGAGAGCACCGTAGTGA[G/A]
GGCTCTTATTTGGAGAAGTTCTATATGGATTTTTTTTTAAAATACGTCGAGCAATGCCCCTTTTTTTCCTGTATGTGTGTTATTGAAAACAAAAGGAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.20% 5.80% 0.00% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 82.80% 17.20% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 89.80% 10.20% 0.00% 0.00% NA
Tropical Japonica  504 68.50% 31.50% 0.00% 0.00% NA
Japonica Intermediate  241 90.50% 9.50% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124256871 C -> T LOC_Os11g40640.1 upstream_gene_variant ; 1297.0bp to feature; MODIFIER silent_mutation Average:34.057; most accessible tissue: Zhenshan97 young leaf, score: 48.658 N N N N
vg1124256871 C -> T LOC_Os11g40630.1 downstream_gene_variant ; 4426.0bp to feature; MODIFIER silent_mutation Average:34.057; most accessible tissue: Zhenshan97 young leaf, score: 48.658 N N N N
vg1124256871 C -> T LOC_Os11g40650.1 downstream_gene_variant ; 2819.0bp to feature; MODIFIER silent_mutation Average:34.057; most accessible tissue: Zhenshan97 young leaf, score: 48.658 N N N N
vg1124256871 C -> T LOC_Os11g40640-LOC_Os11g40650 intergenic_region ; MODIFIER silent_mutation Average:34.057; most accessible tissue: Zhenshan97 young leaf, score: 48.658 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124256871 1.01E-09 NA mr1238 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124256871 NA 3.59E-06 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124256871 3.52E-06 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124256871 9.80E-11 1.44E-18 mr1484 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124256871 4.28E-06 1.18E-06 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124256871 9.84E-10 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124256871 NA 4.58E-06 mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124256871 3.26E-09 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124256871 NA 6.78E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124256871 3.48E-08 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124256871 9.01E-06 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124256871 6.33E-08 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251