Variant ID: vg1124256871 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 24256871 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )
TTTTCCTTTTGTTTTCAATAACACACATACAGGAAAAAAAGGGGCATTGCTCGACGTATTTTAAAAAAAAATCCATATAGAACTTCTCCAAATAAGAGCC[C/T]
TCACTACGGTGCTCTCTGCTGGAAATAGAAAGAAATCCGAACTGTTGATCTCATTTGATCGAAGGGTTTAAATCTATTTGTACTACCACTCTAGTTAGCG
CGCTAACTAGAGTGGTAGTACAAATAGATTTAAACCCTTCGATCAAATGAGATCAACAGTTCGGATTTCTTTCTATTTCCAGCAGAGAGCACCGTAGTGA[G/A]
GGCTCTTATTTGGAGAAGTTCTATATGGATTTTTTTTTAAAATACGTCGAGCAATGCCCCTTTTTTTCCTGTATGTGTGTTATTGAAAACAAAAGGAAAA
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 82.80% | 17.20% | 0.00% | 0.00% | NA |
Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 89.80% | 10.20% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 68.50% | 31.50% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 90.50% | 9.50% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1124256871 | C -> T | LOC_Os11g40640.1 | upstream_gene_variant ; 1297.0bp to feature; MODIFIER | silent_mutation | Average:34.057; most accessible tissue: Zhenshan97 young leaf, score: 48.658 | N | N | N | N |
vg1124256871 | C -> T | LOC_Os11g40630.1 | downstream_gene_variant ; 4426.0bp to feature; MODIFIER | silent_mutation | Average:34.057; most accessible tissue: Zhenshan97 young leaf, score: 48.658 | N | N | N | N |
vg1124256871 | C -> T | LOC_Os11g40650.1 | downstream_gene_variant ; 2819.0bp to feature; MODIFIER | silent_mutation | Average:34.057; most accessible tissue: Zhenshan97 young leaf, score: 48.658 | N | N | N | N |
vg1124256871 | C -> T | LOC_Os11g40640-LOC_Os11g40650 | intergenic_region ; MODIFIER | silent_mutation | Average:34.057; most accessible tissue: Zhenshan97 young leaf, score: 48.658 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1124256871 | 1.01E-09 | NA | mr1238 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1124256871 | NA | 3.59E-06 | mr1238 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1124256871 | 3.52E-06 | NA | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1124256871 | 9.80E-11 | 1.44E-18 | mr1484 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1124256871 | 4.28E-06 | 1.18E-06 | mr1484 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1124256871 | 9.84E-10 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1124256871 | NA | 4.58E-06 | mr1238_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1124256871 | 3.26E-09 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1124256871 | NA | 6.78E-06 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1124256871 | 3.48E-08 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1124256871 | 9.01E-06 | NA | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1124256871 | 6.33E-08 | NA | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |