\
| Variant ID: vg1124078018 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24078018 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TACATGAATTTCTGAAGATCGAGCAGCAGGTGGACTAGAGCTGACTGTGTCCTGAACATGGGTAGACACATCACTGCTCTGATTAGATGGTCCAGGAGTG[C/T]
TGTTCCTGAAATTTGCACTCTTCTGCTGTTGCCATAATTTGCTCTTCTCGATGCCACAGTGGCAAAACAAAGCCCAGATGACGGTTACGAACTCGACACC
GGTGTCGAGTTCGTAACCGTCATCTGGGCTTTGTTTTGCCACTGTGGCATCGAGAAGAGCAAATTATGGCAACAGCAGAAGAGTGCAAATTTCAGGAACA[G/A]
CACTCCTGGACCATCTAATCAGAGCAGTGATGTGTCTACCCATGTTCAGGACACAGTCAGCTCTAGTCCACCTGCTGCTCGATCTTCAGAAATTCATGTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.90% | 17.60% | 0.89% | 43.63% | NA |
| All Indica | 2759 | 32.90% | 2.80% | 1.30% | 62.96% | NA |
| All Japonica | 1512 | 45.90% | 40.40% | 0.20% | 13.49% | NA |
| Aus | 269 | 23.80% | 44.60% | 1.12% | 30.48% | NA |
| Indica I | 595 | 5.00% | 2.20% | 1.68% | 91.09% | NA |
| Indica II | 465 | 27.10% | 1.90% | 0.22% | 70.75% | NA |
| Indica III | 913 | 54.80% | 1.10% | 1.10% | 43.04% | NA |
| Indica Intermediate | 786 | 32.20% | 5.70% | 1.91% | 60.18% | NA |
| Temperate Japonica | 767 | 39.40% | 52.90% | 0.13% | 7.56% | NA |
| Tropical Japonica | 504 | 52.80% | 33.30% | 0.00% | 13.89% | NA |
| Japonica Intermediate | 241 | 52.30% | 15.40% | 0.83% | 31.54% | NA |
| VI/Aromatic | 96 | 86.50% | 1.00% | 0.00% | 12.50% | NA |
| Intermediate | 90 | 44.40% | 25.60% | 0.00% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124078018 | C -> T | LOC_Os11g40390.1 | missense_variant ; p.Ser393Asn; MODERATE | nonsynonymous_codon ; S393N | Average:20.029; most accessible tissue: Callus, score: 86.44 | unknown | unknown | TOLERATED | 1.00 |
| vg1124078018 | C -> DEL | LOC_Os11g40390.1 | N | frameshift_variant | Average:20.029; most accessible tissue: Callus, score: 86.44 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124078018 | 4.41E-06 | NA | mr1088_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078018 | 4.45E-06 | NA | mr1131_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078018 | 2.75E-06 | NA | mr1199_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078018 | 4.86E-06 | NA | mr1246_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078018 | NA | 5.08E-06 | mr1407_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078018 | 4.33E-06 | 3.72E-06 | mr1595_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078018 | NA | 2.34E-06 | mr1600_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078018 | 5.93E-06 | 2.64E-06 | mr1609_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078018 | 5.07E-06 | NA | mr1763_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078018 | 3.87E-08 | 3.87E-08 | mr1852_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078018 | NA | 6.77E-06 | mr1888_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124078018 | 6.86E-07 | 1.63E-06 | mr1909_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |