Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1123928854:

Variant ID: vg1123928854 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 23928854
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.58, G: 0.45, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:


GGCTGCCCTGGATGTCGTAGATGAGCGCATAGCTAATGCGGGCGTACTCGCCGCTGCCGTAGCACTGCACGTTGGGCGTCCACTCCAGCGTCCCCGTGTC[A/G]
AACGCCCTAGCGGGAAGCCCCTGCTTGTCGGCGGCGGCGGCGCCGCCGACGGGGAAGACGCACGTGAGGGAGACGGTCCTGTACTGGAACAGGCGGTGGC

Reverse complement sequence

GCCACCGCCTGTTCCAGTACAGGACCGTCTCCCTCACGTGCGTCTTCCCCGTCGGCGGCGCCGCCGCCGCCGACAAGCAGGGGCTTCCCGCTAGGGCGTT[T/C]
GACACGGGGACGCTGGAGTGGACGCCCAACGTGCAGTGCTACGGCAGCGGCGAGTACGCCCGCATTAGCTATGCGCTCATCTACGACATCCAGGGCAGCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.50% 16.90% 12.67% 29.94% NA
All Indica  2759 54.00% 2.50% 18.59% 24.86% NA
All Japonica  1512 15.10% 37.40% 3.77% 43.72% NA
Aus  269 56.10% 33.80% 4.46% 5.58% NA
Indica I  595 63.50% 2.00% 25.04% 9.41% NA
Indica II  465 56.60% 0.90% 17.42% 25.16% NA
Indica III  913 48.60% 1.30% 15.22% 34.83% NA
Indica Intermediate  786 51.70% 5.20% 18.32% 24.81% NA
Temperate Japonica  767 7.70% 46.20% 2.35% 43.81% NA
Tropical Japonica  504 20.40% 34.70% 4.17% 40.67% NA
Japonica Intermediate  241 27.80% 14.90% 7.47% 49.79% NA
VI/Aromatic  96 5.20% 55.20% 7.29% 32.29% NA
Intermediate  90 41.10% 23.30% 11.11% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1123928854 A -> DEL LOC_Os11g40110.1 N frameshift_variant Average:40.872; most accessible tissue: Zhenshan97 panicle, score: 92.66 N N N N
vg1123928854 A -> G LOC_Os11g40110.1 synonymous_variant ; p.Phe62Phe; LOW synonymous_codon Average:40.872; most accessible tissue: Zhenshan97 panicle, score: 92.66 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1123928854 A G -0.01 -0.02 -0.01 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1123928854 3.26E-06 3.26E-06 mr1317 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251