\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1123627766:

Variant ID: vg1123627766 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 23627766
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAATTTTAGTTTTTTTTTTGTCTCCTCTCTTAAGAGCTATCACTCATTTCATATAGGTTGCTTTATTGTTTCTGATTGCGTTTTATACCACTTCTCTTA[T/C]
ACTATACTCAGATATGAAATAGGGAAGATGGATAAATTTGATAGGTTTCGTGATAGCGATGTCAGTAATTTGACGAGTTTTGTGATAATGATATATATGT

Reverse complement sequence

ACATATATATCATTATCACAAAACTCGTCAAATTACTGACATCGCTATCACGAAACCTATCAAATTTATCCATCTTCCCTATTTCATATCTGAGTATAGT[A/G]
TAAGAGAAGTGGTATAAAACGCAATCAGAAACAATAAAGCAACCTATATGAAATGAGTGATAGCTCTTAAGAGAGGAGACAAAAAAAAAACTAAAATTGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.50% 44.40% 0.11% 0.00% NA
All Indica  2759 41.30% 58.50% 0.18% 0.00% NA
All Japonica  1512 85.60% 14.40% 0.00% 0.00% NA
Aus  269 20.10% 79.90% 0.00% 0.00% NA
Indica I  595 55.80% 44.20% 0.00% 0.00% NA
Indica II  465 72.50% 27.50% 0.00% 0.00% NA
Indica III  913 21.20% 78.60% 0.11% 0.00% NA
Indica Intermediate  786 35.20% 64.20% 0.51% 0.00% NA
Temperate Japonica  767 97.30% 2.70% 0.00% 0.00% NA
Tropical Japonica  504 79.60% 20.40% 0.00% 0.00% NA
Japonica Intermediate  241 61.40% 38.60% 0.00% 0.00% NA
VI/Aromatic  96 76.00% 24.00% 0.00% 0.00% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1123627766 T -> C LOC_Os11g39670.1 upstream_gene_variant ; 416.0bp to feature; MODIFIER silent_mutation Average:73.583; most accessible tissue: Callus, score: 93.858 N N N N
vg1123627766 T -> C LOC_Os11g39670.2 upstream_gene_variant ; 416.0bp to feature; MODIFIER silent_mutation Average:73.583; most accessible tissue: Callus, score: 93.858 N N N N
vg1123627766 T -> C LOC_Os11g39660.1 downstream_gene_variant ; 2223.0bp to feature; MODIFIER silent_mutation Average:73.583; most accessible tissue: Callus, score: 93.858 N N N N
vg1123627766 T -> C LOC_Os11g39660-LOC_Os11g39670 intergenic_region ; MODIFIER silent_mutation Average:73.583; most accessible tissue: Callus, score: 93.858 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1123627766 T C -0.11 -0.06 -0.05 -0.02 -0.07 -0.1

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1123627766 3.73E-08 1.64E-24 mr1133 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123627766 2.96E-07 5.62E-14 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123627766 NA 7.17E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123627766 1.41E-06 1.37E-15 mr1667 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123627766 4.35E-06 2.02E-09 mr1667 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123627766 NA 2.30E-14 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123627766 NA 2.34E-09 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123627766 NA 1.53E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123627766 NA 8.77E-07 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123627766 NA 2.75E-07 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123627766 NA 7.77E-07 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251