Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1123611068:

Variant ID: vg1123611068 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 23611068
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.60, C: 0.39, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:

CCATCGCCGTCTCCTCCTCTTCTCCGGCGTCCAAGAACCCCTCCCGTGCCCCGGCCATGCCGCCGCCGGAGCCGGACAAGGACAAGCCGCTGCCGAAGCC[C/G]
AAGCCGCCCAAGCCCAAGCCCAAGCCGCCCAAGCCGGAGCCGGAGCCGAACACGCGCTCGGCGCCGGAGCGCGACCAGACGGCCGCCCCGTACGGCACGG

Reverse complement sequence

CCGTGCCGTACGGGGCGGCCGTCTGGTCGCGCTCCGGCGCCGAGCGCGTGTTCGGCTCCGGCTCCGGCTTGGGCGGCTTGGGCTTGGGCTTGGGCGGCTT[G/C]
GGCTTCGGCAGCGGCTTGTCCTTGTCCGGCTCCGGCGGCGGCATGGCCGGGGCACGGGAGGGGTTCTTGGACGCCGGAGAAGAGGAGGAGACGGCGATGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.00%	33.10%	4.08%	1.90%	NA
All Indica	2759	56.70%	34.10%	6.23%	2.90%	NA
All Japonica	1512	67.40%	32.30%	0.26%	0.00%	NA
Aus	269	72.90%	18.20%	5.20%	3.72%	NA
Indica I	595	37.80%	49.90%	11.09%	1.18%	NA
Indica II	465	29.90%	68.40%	0.86%	0.86%	NA
Indica III	913	79.40%	8.50%	5.91%	6.13%	NA
Indica Intermediate	786	60.60%	31.70%	6.11%	1.65%	NA
Temperate Japonica	767	68.10%	31.80%	0.13%	0.00%	NA
Tropical Japonica	504	58.10%	41.90%	0.00%	0.00%	NA
Japonica Intermediate	241	84.60%	14.10%	1.24%	0.00%	NA
VI/Aromatic	96	61.50%	37.50%	1.04%	0.00%	NA
Intermediate	90	46.70%	51.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1123611068	C -> DEL	LOC_Os11g39640.1	N	frameshift_variant	Average:98.335; most accessible tissue: Minghui63 flag leaf, score: 99.689	N	N	N	N
vg1123611068	C -> G	LOC_Os11g39640.1	synonymous_variant ; p.Pro15Pro; LOW	synonymous_codon	Average:98.335; most accessible tissue: Minghui63 flag leaf, score: 99.689	N	N	N	N
vg1123611068	C -> G	LOC_Os11g39640.1	synonymous_variant ; p.Pro15Pro; LOW	nonsynonymous_codon ; P15L	Average:98.335; most accessible tissue: Minghui63 flag leaf, score: 99.689	unknown	unknown	DELETERIOUS	0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1123611068	C	G	-0.04	-0.05	-0.01	-0.05	-0.02	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1123611068	1.76E-07	6.45E-16	mr1133	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123611068	8.30E-06	7.93E-10	mr1667	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123611068	NA	5.02E-09	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123611068	NA	1.68E-06	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123611068	NA	1.02E-06	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123611068	NA	3.59E-07	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123611068	NA	2.14E-07	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123611068	NA	1.21E-06	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123611068	NA	9.22E-08	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123611068	NA	5.35E-07	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251