\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1123406801:

Variant ID: vg1123406801 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 23406801
Reference Allele: AAlternative Allele: G,C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


ACGGCAGCAGCCTCGACTTGGGCTGCTTGATGCAGTGATGGCATGAGCTCCGAGCTTGGGAGCTTGAGGCGTGGATCATTGGAGAACACACGGTAGAGAT[A/G,C]
GTACGCCTTACCCGGAGTGTCATAGTTGAAAGACATTGGGCGGCGGAAGCACCGCATGGGTGGTTTTCGCAGCAGCGAGCGAGGTGCTTCTTCTCGGTGC

Reverse complement sequence

GCACCGAGAAGAAGCACCTCGCTCGCTGCTGCGAAAACCACCCATGCGGTGCTTCCGCCGCCCAATGTCTTTCAACTATGACACTCCGGGTAAGGCGTAC[T/C,G]
ATCTCTACCGTGTGTTCTCCAATGATCCACGCCTCAAGCTCCCAAGCTCGGAGCTCATGCCATCACTGCATCAAGCAGCCCAAGTCGAGGCTGCTGCCGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.30% 12.30% 1.59% 2.03% G: 6.71%
All Indica  2759 74.60% 17.40% 0.29% 3.04% G: 4.64%
All Japonica  1512 82.70% 5.40% 3.64% 0.00% G: 8.20%
Aus  269 72.90% 2.60% 0.37% 4.46% G: 19.70%
Indica I  595 80.20% 17.50% 0.50% 1.18% G: 0.67%
Indica II  465 95.30% 2.80% 0.65% 0.22% G: 1.08%
Indica III  913 57.00% 29.00% 0.00% 3.40% G: 10.62%
Indica Intermediate  786 78.80% 12.50% 0.25% 5.73% G: 2.80%
Temperate Japonica  767 73.70% 7.00% 7.04% 0.00% G: 12.26%
Tropical Japonica  504 97.40% 2.40% 0.00% 0.00% G: 0.20%
Japonica Intermediate  241 80.90% 6.60% 0.41% 0.00% G: 12.03%
VI/Aromatic  96 76.00% 10.40% 7.29% 0.00% G: 6.25%
Intermediate  90 84.40% 4.40% 4.44% 0.00% G: 6.67%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1123406801 A -> DEL LOC_Os11g39310.1 N frameshift_variant Average:73.941; most accessible tissue: Zhenshan97 flag leaf, score: 87.087 N N N N
vg1123406801 A -> G LOC_Os11g39310.1 missense_variant ; p.Tyr54His; MODERATE nonsynonymous_codon ; Y54R Average:73.941; most accessible tissue: Zhenshan97 flag leaf, score: 87.087 unknown unknown TOLERATED 0.49
vg1123406801 A -> G LOC_Os11g39310.1 missense_variant ; p.Tyr54His; MODERATE nonsynonymous_codon ; Y54L Average:73.941; most accessible tissue: Zhenshan97 flag leaf, score: 87.087 unknown unknown TOLERATED 0.72
vg1123406801 A -> G LOC_Os11g39310.1 missense_variant ; p.Tyr54His; MODERATE nonsynonymous_codon ; Y54Q Average:73.941; most accessible tissue: Zhenshan97 flag leaf, score: 87.087 unknown unknown TOLERATED 0.46
vg1123406801 A -> G LOC_Os11g39310.1 missense_variant ; p.Tyr54His; MODERATE nonsynonymous_codon ; Y54H Average:73.941; most accessible tissue: Zhenshan97 flag leaf, score: 87.087 unknown unknown TOLERATED 0.57
vg1123406801 A -> C LOC_Os11g39310.1 missense_variant ; p.Tyr54Asp; MODERATE nonsynonymous_codon ; Y54D Average:73.941; most accessible tissue: Zhenshan97 flag leaf, score: 87.087 unknown unknown TOLERATED 0.40

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1123406801 A C -0.01 -0.01 -0.01 -0.02 -0.02 -0.02
vg1123406801 A G 0.01 0.0 0.02 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1123406801 NA 8.72E-06 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123406801 NA 1.55E-06 mr1109_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123406801 NA 1.32E-06 mr1402_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251