Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1123394499:

Variant ID: vg1123394499 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 23394499
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCTCCAAGAGCCCTGGCTTCCTCCGGGGCCTTTGACCAGCCCCAGAAGCCTTGATAGAGTCTGGAAGCCTCAAATGGTTCCAGAGCGTACGGAGAGCTTC[G/A]
GAGGCCTTGGTCGGCTCCGGAGCCCTCGAATAGTTCCGGAGCTTATGGATGGCTCGGAGGCCTTGGTCGGCTCCAGAGACCTTGAACGACCCCGGAGCCC

Reverse complement sequence

GGGCTCCGGGGTCGTTCAAGGTCTCTGGAGCCGACCAAGGCCTCCGAGCCATCCATAAGCTCCGGAACTATTCGAGGGCTCCGGAGCCGACCAAGGCCTC[C/T]
GAAGCTCTCCGTACGCTCTGGAACCATTTGAGGCTTCCAGACTCTATCAAGGCTTCTGGGGCTGGTCAAAGGCCCCGGAGGAAGCCAGGGCTCTTGGAGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.50%	3.00%	1.35%	53.15%	NA
All Indica	2759	35.80%	0.10%	1.27%	62.81%	NA
All Japonica	1512	58.70%	8.30%	0.73%	32.21%	NA
Aus	269	26.00%	0.00%	4.09%	69.89%	NA
Indica I	595	62.40%	0.00%	0.50%	37.14%	NA
Indica II	465	7.70%	0.00%	0.86%	91.40%	NA
Indica III	913	34.20%	0.20%	1.53%	64.07%	NA
Indica Intermediate	786	34.20%	0.10%	1.78%	63.87%	NA
Temperate Japonica	767	67.70%	8.30%	0.65%	23.34%	NA
Tropical Japonica	504	50.80%	11.50%	0.60%	37.10%	NA
Japonica Intermediate	241	46.90%	1.70%	1.24%	50.21%	NA
VI/Aromatic	96	24.00%	9.40%	2.08%	64.58%	NA
Intermediate	90	43.30%	4.40%	5.56%	46.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1123394499	G -> A	LOC_Os11g39290.1	missense_variant ; p.Gly10Arg; MODERATE	nonsynonymous_codon ; G10R	Average:41.523; most accessible tissue: Zhenshan97 panicle, score: 91.206	unknown	unknown	DELETERIOUS	0.00
vg1123394499	G -> DEL	LOC_Os11g39290.1	N	frameshift_variant	Average:41.523; most accessible tissue: Zhenshan97 panicle, score: 91.206	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1123394499	G	A	0.02	0.0	0.0	0.01	0.02	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1123394499	4.56E-06	4.56E-06	mr1067	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123394499	4.42E-06	4.42E-06	mr1068	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123394499	NA	4.42E-06	mr1078	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123394499	1.62E-07	1.62E-07	mr1200	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123394499	2.59E-06	1.30E-06	mr1211	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123394499	5.79E-06	NA	mr1671	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123394499	9.49E-06	9.49E-06	mr1750	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123394499	4.23E-06	4.23E-06	mr1855	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251