Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1123051767:

Variant ID: vg1123051767 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 23051767
Reference Allele: C	Alternative Allele: T,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

TATGTGTTCACATGAACATCCCCACACATACACATCATATAAAAAAATCAATAATCAGATAGCTTAACGACTATAATTTTAAAAGTTGTACTCCCTCCGT[C/T,A]
CCAAAATATAATAACTTTTAGCCCTTGGGATTTGTCCCAAAATATAACAACTTCTCCACCAATATTCTTTTTCCAACCAATCACAACTATCCACCATTCA

Reverse complement sequence

TGAATGGTGGATAGTTGTGATTGGTTGGAAAAAGAATATTGGTGGAGAAGTTGTTATATTTTGGGACAAATCCCAAGGGCTAAAAGTTATTATATTTTGG[G/A,T]
ACGGAGGGAGTACAACTTTTAAAATTATAGTCGTTAAGCTATCTGATTATTGATTTTTTTATATGATGTGTATGTGTGGGGATGTTCATGTGAACACATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.10%	30.40%	0.19%	10.71%	A: 0.55%
All Indica	2759	46.40%	38.90%	0.11%	13.74%	A: 0.94%
All Japonica	1512	87.10%	11.00%	0.00%	1.85%	NA
Aus	269	4.80%	63.90%	2.23%	29.00%	NA
Indica I	595	76.60%	11.40%	0.17%	11.76%	NA
Indica II	465	31.60%	65.80%	0.00%	2.58%	NA
Indica III	913	31.40%	40.50%	0.22%	24.97%	A: 2.85%
Indica Intermediate	786	49.50%	41.70%	0.00%	8.78%	NA
Temperate Japonica	767	95.40%	2.30%	0.00%	2.22%	NA
Tropical Japonica	504	79.40%	19.40%	0.00%	1.19%	NA
Japonica Intermediate	241	76.80%	21.20%	0.00%	2.07%	NA
VI/Aromatic	96	86.50%	0.00%	0.00%	13.54%	NA
Intermediate	90	61.10%	30.00%	0.00%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1123051767	C -> T	LOC_Os11g38765.1	downstream_gene_variant ; 1310.0bp to feature; MODIFIER	silent_mutation	Average:35.898; most accessible tissue: Callus, score: 49.869	N	N	N	N
vg1123051767	C -> T	LOC_Os11g38760-LOC_Os11g38765	intergenic_region ; MODIFIER	silent_mutation	Average:35.898; most accessible tissue: Callus, score: 49.869	N	N	N	N
vg1123051767	C -> A	LOC_Os11g38765.1	downstream_gene_variant ; 1310.0bp to feature; MODIFIER	silent_mutation	Average:35.898; most accessible tissue: Callus, score: 49.869	N	N	N	N
vg1123051767	C -> A	LOC_Os11g38760-LOC_Os11g38765	intergenic_region ; MODIFIER	silent_mutation	Average:35.898; most accessible tissue: Callus, score: 49.869	N	N	N	N
vg1123051767	C -> DEL	N	N	silent_mutation	Average:35.898; most accessible tissue: Callus, score: 49.869	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1123051767	1.31E-06	4.98E-08	mr1696	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123051767	NA	1.84E-09	mr1935	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123051767	NA	2.48E-09	mr1715_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251