\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1123051767:

Variant ID: vg1123051767 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 23051767
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


TATGTGTTCACATGAACATCCCCACACATACACATCATATAAAAAAATCAATAATCAGATAGCTTAACGACTATAATTTTAAAAGTTGTACTCCCTCCGT[C/T,A]
CCAAAATATAATAACTTTTAGCCCTTGGGATTTGTCCCAAAATATAACAACTTCTCCACCAATATTCTTTTTCCAACCAATCACAACTATCCACCATTCA

Reverse complement sequence

TGAATGGTGGATAGTTGTGATTGGTTGGAAAAAGAATATTGGTGGAGAAGTTGTTATATTTTGGGACAAATCCCAAGGGCTAAAAGTTATTATATTTTGG[G/A,T]
ACGGAGGGAGTACAACTTTTAAAATTATAGTCGTTAAGCTATCTGATTATTGATTTTTTTATATGATGTGTATGTGTGGGGATGTTCATGTGAACACATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.10% 30.40% 0.19% 10.71% A: 0.55%
All Indica  2759 46.40% 38.90% 0.11% 13.74% A: 0.94%
All Japonica  1512 87.10% 11.00% 0.00% 1.85% NA
Aus  269 4.80% 63.90% 2.23% 29.00% NA
Indica I  595 76.60% 11.40% 0.17% 11.76% NA
Indica II  465 31.60% 65.80% 0.00% 2.58% NA
Indica III  913 31.40% 40.50% 0.22% 24.97% A: 2.85%
Indica Intermediate  786 49.50% 41.70% 0.00% 8.78% NA
Temperate Japonica  767 95.40% 2.30% 0.00% 2.22% NA
Tropical Japonica  504 79.40% 19.40% 0.00% 1.19% NA
Japonica Intermediate  241 76.80% 21.20% 0.00% 2.07% NA
VI/Aromatic  96 86.50% 0.00% 0.00% 13.54% NA
Intermediate  90 61.10% 30.00% 0.00% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1123051767 C -> T LOC_Os11g38765.1 downstream_gene_variant ; 1310.0bp to feature; MODIFIER silent_mutation Average:35.898; most accessible tissue: Callus, score: 49.869 N N N N
vg1123051767 C -> T LOC_Os11g38760-LOC_Os11g38765 intergenic_region ; MODIFIER silent_mutation Average:35.898; most accessible tissue: Callus, score: 49.869 N N N N
vg1123051767 C -> A LOC_Os11g38765.1 downstream_gene_variant ; 1310.0bp to feature; MODIFIER silent_mutation Average:35.898; most accessible tissue: Callus, score: 49.869 N N N N
vg1123051767 C -> A LOC_Os11g38760-LOC_Os11g38765 intergenic_region ; MODIFIER silent_mutation Average:35.898; most accessible tissue: Callus, score: 49.869 N N N N
vg1123051767 C -> DEL N N silent_mutation Average:35.898; most accessible tissue: Callus, score: 49.869 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1123051767 1.31E-06 4.98E-08 mr1696 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123051767 NA 1.84E-09 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123051767 NA 2.48E-09 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251