Search for Variation information by Variation ID:
Detailed information for vg1122942578:
| Variant ID: vg1122942578 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22942578 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.00, others allele: 0.00, population size: 313. )
Flanking Sequence (100 bp) in Reference Genome:
CCAAAGTGACCGTGTGAAATGACTTTCAACTTGTGAAAATGATTGTGGCCCTCCGACGATCCACAAAAACATCGCCAATGACTCAATGGATGAAACATTG[T/C]
TGCTCGAGCTCAATCCGTAGGTAGAGACTAGCAAGTCATGAAGTGCATGAAAAATCTCAGGGCTCATCCGAAACATCTTATAAAAATACCTTGGACGATC
Reverse complement sequence
GATCGTCCAAGGTATTTTTATAAGATGTTTCGGATGAGCCCTGAGATTTTTCATGCACTTCATGACTTGCTAGTCTCTACCTACGGATTGAGCTCGAGCA[A/G]
CAATGTTTCATCCATTGAGTCATTGGCGATGTTTTTGTGGATCGTCGGAGGGCCACAATCATTTTCACAAGTTGAAAGTCATTTCACACGGTCACTTTGG
Allele Frequencies:
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.80% | 12.70% | 0.44% | 1.10% | NA |
| All Indica | 2759 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 57.20% | 38.00% | 1.39% | 3.37% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 37.30% | 61.40% | 0.78% | 0.52% | NA |
| Tropical Japonica | 504 | 77.80% | 11.50% | 1.98% | 8.73% | NA |
| Japonica Intermediate | 241 | 77.60% | 19.10% | 2.07% | 1.24% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 8.90% | 0.00% | 1.11% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122942578 | T -> DEL | LOC_Os11g38660.1 | N | frameshift_variant | Average:21.098; most accessible tissue: Zhenshan97 flag leaf, score: 34.199 | N | N | N | N |
| vg1122942578 | T -> C | LOC_Os11g38660.1 | missense_variant ; p.Asn347Ser; MODERATE | nonsynonymous_codon | Average:21.098; most accessible tissue: Zhenshan97 flag leaf, score: 34.199 | benign  |
1.177 |
TOLERATED | 0.65 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122942578 | 1.89E-06 | NA | mr1336 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122942578 | 5.76E-06 | 5.76E-06 | mr1336 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122942578 | NA | 6.38E-06 | mr1577 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122942578 | 2.01E-06 | NA | mr1579 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122942578 | NA | 2.23E-07 | mr1579 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122942578 | NA | 3.77E-06 | mr1708 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |