\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122863147:

Variant ID: vg1122863147 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22863147
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 32. )

Flanking Sequence (100 bp) in Reference Genome:


GAGACGTTGTCCATCGCCATTGTGGCACCGGATACAGATAACAAGGAAGTCCTTGATCTTGCACGCGATACTTTGGTTGTTCCAGGCAACTACTACCATC[G/T]
CAGTATCACGGTCAACGTCCCGGCGGTGCACGCCGATTTTTTACCGCTACGACCTAAGGAGATTCTCTACTACATCTTACGGGAGCTCGAGCCCGGATCC

Reverse complement sequence

GGATCCGGGCTCGAGCTCCCGTAAGATGTAGTAGAGAATCTCCTTAGGTCGTAGCGGTAAAAAATCGGCGTGCACCGCCGGGACGTTGACCGTGATACTG[C/A]
GATGGTAGTAGTTGCCTGGAACAACCAAAGTATCGCGTGCAAGATCAAGGACTTCCTTGTTATCTGTATCCGGTGCCACAATGGCGATGGACAACGTCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.20% 10.70% 10.33% 17.71% NA
All Indica  2759 44.40% 14.90% 14.50% 26.21% NA
All Japonica  1512 94.80% 0.60% 1.92% 2.71% NA
Aus  269 63.90% 3.70% 14.87% 17.47% NA
Indica I  595 85.00% 0.80% 5.21% 8.91% NA
Indica II  465 11.60% 37.80% 24.09% 26.45% NA
Indica III  913 38.10% 10.00% 12.81% 39.10% NA
Indica Intermediate  786 40.50% 17.60% 17.81% 24.17% NA
Temperate Japonica  767 97.00% 0.30% 1.17% 1.56% NA
Tropical Japonica  504 91.30% 0.60% 3.37% 4.76% NA
Japonica Intermediate  241 95.00% 1.70% 1.24% 2.07% NA
VI/Aromatic  96 21.90% 67.70% 0.00% 10.42% NA
Intermediate  90 45.60% 15.60% 21.11% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122863147 G -> T LOC_Os11g38580.1 missense_variant ; p.Arg196Leu; MODERATE nonsynonymous_codon ; R196L Average:77.814; most accessible tissue: Minghui63 flag leaf, score: 89.905 benign 1.293 DELETERIOUS 0.03
vg1122863147 G -> DEL LOC_Os11g38580.1 N frameshift_variant Average:77.814; most accessible tissue: Minghui63 flag leaf, score: 89.905 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1122863147 G T -0.03 -0.03 -0.03 -0.04 -0.04 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122863147 2.66E-07 1.83E-09 mr1310 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122863147 NA 6.16E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122863147 5.87E-06 1.40E-12 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122863147 NA 1.38E-08 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122863147 NA 1.85E-10 mr1903 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122863147 NA 5.91E-11 mr1907 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122863147 NA 4.66E-10 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122863147 NA 2.75E-09 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122863147 NA 6.09E-10 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122863147 NA 1.02E-07 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122863147 NA 3.71E-07 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122863147 NA 1.17E-06 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122863147 NA 2.76E-07 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122863147 NA 6.60E-06 mr1338_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122863147 NA 9.23E-06 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122863147 NA 1.22E-07 mr1449_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122863147 NA 1.56E-10 mr1540_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122863147 NA 3.12E-10 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122863147 9.43E-06 NA mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122863147 4.28E-06 7.23E-11 mr1732_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122863147 NA 2.24E-07 mr1836_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122863147 NA 8.12E-06 mr1899_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122863147 NA 1.55E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251