\
| Variant ID: vg1122857152 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22857152 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGACTGTTCCGATATCTGATTTTCCTGAAATCATTACTCAGAACATTTGTTGTACTCTCTTTAGTCGATCTCGGAGTTAACCGTAGAGACCAGGAGTCTT[T/C]
GACAATGATGAATGGAACTTTCCTGAAATCAATACTCATAAAAGAATATTAGATAGAAATAACCCCCGAGCAAACGCTCAAAGGGTGACATGTTATAATA
TATTATAACATGTCACCCTTTGAGCGTTTGCTCGGGGGTTATTTCTATCTAATATTCTTTTATGAGTATTGATTTCAGGAAAGTTCCATTCATCATTGTC[A/G]
AAGACTCCTGGTCTCTACGGTTAACTCCGAGATCGACTAAAGAGAGTACAACAAATGTTCTGAGTAATGATTTCAGGAAAATCAGATATCGGAACAGTCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.70% | 17.10% | 1.27% | 23.89% | NA |
| All Indica | 2759 | 68.60% | 12.10% | 1.23% | 18.01% | NA |
| All Japonica | 1512 | 43.60% | 25.20% | 0.46% | 30.75% | NA |
| Aus | 269 | 16.00% | 27.50% | 5.95% | 50.56% | NA |
| Indica I | 595 | 82.20% | 5.40% | 1.18% | 11.26% | NA |
| Indica II | 465 | 91.80% | 4.50% | 0.00% | 3.66% | NA |
| Indica III | 913 | 44.80% | 24.30% | 1.86% | 29.03% | NA |
| Indica Intermediate | 786 | 72.40% | 7.50% | 1.27% | 18.83% | NA |
| Temperate Japonica | 767 | 47.50% | 36.00% | 0.13% | 16.43% | NA |
| Tropical Japonica | 504 | 50.20% | 9.30% | 0.60% | 39.88% | NA |
| Japonica Intermediate | 241 | 17.40% | 24.10% | 1.24% | 57.26% | NA |
| VI/Aromatic | 96 | 72.90% | 10.40% | 1.04% | 15.62% | NA |
| Intermediate | 90 | 70.00% | 10.00% | 2.22% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122857152 | T -> DEL | N | N | silent_mutation | Average:36.683; most accessible tissue: Minghui63 flag leaf, score: 50.629 | N | N | N | N |
| vg1122857152 | T -> C | LOC_Os11g38560-LOC_Os11g38580 | intergenic_region ; MODIFIER | silent_mutation | Average:36.683; most accessible tissue: Minghui63 flag leaf, score: 50.629 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122857152 | NA | 3.41E-06 | mr1912 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122857152 | NA | 4.40E-06 | mr1912 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122857152 | 1.55E-09 | 2.59E-11 | mr1955 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122857152 | 4.62E-07 | 4.62E-07 | mr1955 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |