\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122857152:

Variant ID: vg1122857152 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22857152
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGACTGTTCCGATATCTGATTTTCCTGAAATCATTACTCAGAACATTTGTTGTACTCTCTTTAGTCGATCTCGGAGTTAACCGTAGAGACCAGGAGTCTT[T/C]
GACAATGATGAATGGAACTTTCCTGAAATCAATACTCATAAAAGAATATTAGATAGAAATAACCCCCGAGCAAACGCTCAAAGGGTGACATGTTATAATA

Reverse complement sequence

TATTATAACATGTCACCCTTTGAGCGTTTGCTCGGGGGTTATTTCTATCTAATATTCTTTTATGAGTATTGATTTCAGGAAAGTTCCATTCATCATTGTC[A/G]
AAGACTCCTGGTCTCTACGGTTAACTCCGAGATCGACTAAAGAGAGTACAACAAATGTTCTGAGTAATGATTTCAGGAAAATCAGATATCGGAACAGTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.70% 17.10% 1.27% 23.89% NA
All Indica  2759 68.60% 12.10% 1.23% 18.01% NA
All Japonica  1512 43.60% 25.20% 0.46% 30.75% NA
Aus  269 16.00% 27.50% 5.95% 50.56% NA
Indica I  595 82.20% 5.40% 1.18% 11.26% NA
Indica II  465 91.80% 4.50% 0.00% 3.66% NA
Indica III  913 44.80% 24.30% 1.86% 29.03% NA
Indica Intermediate  786 72.40% 7.50% 1.27% 18.83% NA
Temperate Japonica  767 47.50% 36.00% 0.13% 16.43% NA
Tropical Japonica  504 50.20% 9.30% 0.60% 39.88% NA
Japonica Intermediate  241 17.40% 24.10% 1.24% 57.26% NA
VI/Aromatic  96 72.90% 10.40% 1.04% 15.62% NA
Intermediate  90 70.00% 10.00% 2.22% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122857152 T -> DEL N N silent_mutation Average:36.683; most accessible tissue: Minghui63 flag leaf, score: 50.629 N N N N
vg1122857152 T -> C LOC_Os11g38560-LOC_Os11g38580 intergenic_region ; MODIFIER silent_mutation Average:36.683; most accessible tissue: Minghui63 flag leaf, score: 50.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122857152 NA 3.41E-06 mr1912 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122857152 NA 4.40E-06 mr1912 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122857152 1.55E-09 2.59E-11 mr1955 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122857152 4.62E-07 4.62E-07 mr1955 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251