Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1122800334:

Variant ID: vg1122800334 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22800334
Reference Allele: T	Alternative Allele: G,C
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATGGGTTGCAGAAGGTTTGACACTCAAGGAAGATTGGTCCAGTTCTGTGCATCAGGCAAAGATTTGATGCCCTCATCCATCGGTATCTTGTTTGTCCTG[T/G,C]
TGATATTGGTGGCACAGGAAAGGTGAAGAGCTGTGTGGTAAATGATCCAGTTCATGGGTTCATTACCACAATTGCCAGAAAACAACATATTGTGGAGACA

Reverse complement sequence

TGTCTCCACAATATGTTGTTTTCTGGCAATTGTGGTAATGAACCCATGAACTGGATCATTTACCACACAGCTCTTCACCTTTCCTGTGCCACCAATATCA[A/C,G]
CAGGACAAACAAGATACCGATGGATGAGGGCATCAAATCTTTGCCTGATGCACAGAACTGGACCAATCTTCCTTGAGTGTCAAACCTTCTGCAACCCATT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.50%	24.60%	3.07%	13.25%	C: 1.54%
All Indica	2759	50.70%	34.70%	2.28%	11.24%	C: 1.16%
All Japonica	1512	74.80%	11.00%	2.51%	9.85%	C: 1.85%
Aus	269	26.00%	9.70%	8.92%	51.67%	C: 3.72%
Indica I	595	18.20%	77.00%	0.84%	4.03%	NA
Indica II	465	91.60%	4.70%	1.72%	0.86%	C: 1.08%
Indica III	913	41.90%	28.10%	4.05%	24.32%	C: 1.53%
Indica Intermediate	786	61.20%	27.90%	1.65%	7.63%	C: 1.65%
Temperate Japonica	767	71.60%	11.00%	1.17%	16.17%	C: 0.13%
Tropical Japonica	504	79.60%	7.70%	4.37%	3.77%	C: 4.56%
Japonica Intermediate	241	75.10%	17.80%	2.90%	2.49%	C: 1.66%
VI/Aromatic	96	56.20%	7.30%	13.54%	22.92%	NA
Intermediate	90	72.20%	10.00%	7.78%	6.67%	C: 3.33%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122800334	T -> DEL	N	N	silent_mutation	Average:55.829; most accessible tissue: Minghui63 flag leaf, score: 84.608	N	N	N	N
vg1122800334	T -> G	LOC_Os11g38480.1	5_prime_UTR_variant ; 296.0bp to feature; MODIFIER	silent_mutation	Average:55.829; most accessible tissue: Minghui63 flag leaf, score: 84.608	N	N	N	N
vg1122800334	T -> G	LOC_Os11g38470.1	upstream_gene_variant ; 4672.0bp to feature; MODIFIER	silent_mutation	Average:55.829; most accessible tissue: Minghui63 flag leaf, score: 84.608	N	N	N	N
vg1122800334	T -> C	LOC_Os11g38480.1	5_prime_UTR_premature_start_codon_gain_variant ; LOW	silent_mutation	Average:55.829; most accessible tissue: Minghui63 flag leaf, score: 84.608	N	N	N	N
vg1122800334	T -> C	LOC_Os11g38480.1	5_prime_UTR_variant ; 296.0bp to feature; MODIFIER	silent_mutation	Average:55.829; most accessible tissue: Minghui63 flag leaf, score: 84.608	N	N	N	N
vg1122800334	T -> C	LOC_Os11g38470.1	upstream_gene_variant ; 4672.0bp to feature; MODIFIER	silent_mutation	Average:55.829; most accessible tissue: Minghui63 flag leaf, score: 84.608	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122800334	NA	7.34E-06	mr1074	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122800334	1.61E-06	NA	mr1378	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122800334	NA	2.14E-06	mr1378	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122800334	NA	1.51E-08	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122800334	NA	3.08E-07	mr1805_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251