\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122612595:

Variant ID: vg1122612595 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22612595
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, T: 0.21, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


GCCGCCATGGTGGCCGCCGCGACCGCGAGGAAACCCTAACCCTAGTTGGAGCCCTAAAAACAATGGGAATTGGGGATTTCTTTCTTTGCTTCGTCCCTCG[C/T]
GCGCGTCCTCACTTCGTCTTCTCGGATTCGTCGAGCAGCGCTGACCTCTCAAGAGGCAACTTTTCCTCTTTCTTCTTGGTGATTTGGTTCGCTCTTGCAT

Reverse complement sequence

ATGCAAGAGCGAACCAAATCACCAAGAAGAAAGAGGAAAAGTTGCCTCTTGAGAGGTCAGCGCTGCTCGACGAATCCGAGAAGACGAAGTGAGGACGCGC[G/A]
CGAGGGACGAAGCAAAGAAAGAAATCCCCAATTCCCATTGTTTTTAGGGCTCCAACTAGGGTTAGGGTTTCCTCGCGGTCGCGGCGGCCACCATGGCGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.20% 38.30% 6.56% 8.89% NA
All Indica  2759 23.10% 52.90% 10.26% 13.81% NA
All Japonica  1512 84.70% 13.60% 0.79% 0.86% NA
Aus  269 81.40% 13.00% 2.23% 3.35% NA
Indica I  595 6.10% 83.90% 4.54% 5.55% NA
Indica II  465 35.10% 35.30% 17.20% 12.47% NA
Indica III  913 21.20% 48.80% 7.01% 22.89% NA
Indica Intermediate  786 30.90% 44.50% 14.25% 10.31% NA
Temperate Japonica  767 91.10% 7.00% 1.04% 0.78% NA
Tropical Japonica  504 79.60% 18.50% 0.79% 1.19% NA
Japonica Intermediate  241 75.10% 24.50% 0.00% 0.41% NA
VI/Aromatic  96 7.30% 85.40% 1.04% 6.25% NA
Intermediate  90 45.60% 33.30% 8.89% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122612595 C -> T LOC_Os11g38130.1 upstream_gene_variant ; 73.0bp to feature; MODIFIER silent_mutation Average:84.573; most accessible tissue: Minghui63 young leaf, score: 92.158 N N N N
vg1122612595 C -> T LOC_Os11g38140.1 downstream_gene_variant ; 2282.0bp to feature; MODIFIER silent_mutation Average:84.573; most accessible tissue: Minghui63 young leaf, score: 92.158 N N N N
vg1122612595 C -> T LOC_Os11g38130-LOC_Os11g38140 intergenic_region ; MODIFIER silent_mutation Average:84.573; most accessible tissue: Minghui63 young leaf, score: 92.158 N N N N
vg1122612595 C -> DEL N N silent_mutation Average:84.573; most accessible tissue: Minghui63 young leaf, score: 92.158 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122612595 NA 2.22E-08 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122612595 NA 3.03E-07 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122612595 NA 5.92E-06 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122612595 NA 1.64E-06 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122612595 NA 2.90E-06 mr1404 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122612595 2.98E-07 4.88E-10 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122612595 NA 2.58E-06 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122612595 NA 7.45E-07 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122612595 1.77E-07 1.77E-07 mr1795 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122612595 4.67E-06 4.26E-09 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122612595 NA 1.93E-06 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122612595 NA 3.86E-07 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251