\
| Variant ID: vg1122612595 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22612595 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, T: 0.21, others allele: 0.00, population size: 82. )
GCCGCCATGGTGGCCGCCGCGACCGCGAGGAAACCCTAACCCTAGTTGGAGCCCTAAAAACAATGGGAATTGGGGATTTCTTTCTTTGCTTCGTCCCTCG[C/T]
GCGCGTCCTCACTTCGTCTTCTCGGATTCGTCGAGCAGCGCTGACCTCTCAAGAGGCAACTTTTCCTCTTTCTTCTTGGTGATTTGGTTCGCTCTTGCAT
ATGCAAGAGCGAACCAAATCACCAAGAAGAAAGAGGAAAAGTTGCCTCTTGAGAGGTCAGCGCTGCTCGACGAATCCGAGAAGACGAAGTGAGGACGCGC[G/A]
CGAGGGACGAAGCAAAGAAAGAAATCCCCAATTCCCATTGTTTTTAGGGCTCCAACTAGGGTTAGGGTTTCCTCGCGGTCGCGGCGGCCACCATGGCGGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 46.20% | 38.30% | 6.56% | 8.89% | NA |
| All Indica | 2759 | 23.10% | 52.90% | 10.26% | 13.81% | NA |
| All Japonica | 1512 | 84.70% | 13.60% | 0.79% | 0.86% | NA |
| Aus | 269 | 81.40% | 13.00% | 2.23% | 3.35% | NA |
| Indica I | 595 | 6.10% | 83.90% | 4.54% | 5.55% | NA |
| Indica II | 465 | 35.10% | 35.30% | 17.20% | 12.47% | NA |
| Indica III | 913 | 21.20% | 48.80% | 7.01% | 22.89% | NA |
| Indica Intermediate | 786 | 30.90% | 44.50% | 14.25% | 10.31% | NA |
| Temperate Japonica | 767 | 91.10% | 7.00% | 1.04% | 0.78% | NA |
| Tropical Japonica | 504 | 79.60% | 18.50% | 0.79% | 1.19% | NA |
| Japonica Intermediate | 241 | 75.10% | 24.50% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 7.30% | 85.40% | 1.04% | 6.25% | NA |
| Intermediate | 90 | 45.60% | 33.30% | 8.89% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122612595 | C -> T | LOC_Os11g38130.1 | upstream_gene_variant ; 73.0bp to feature; MODIFIER | silent_mutation | Average:84.573; most accessible tissue: Minghui63 young leaf, score: 92.158 | N | N | N | N |
| vg1122612595 | C -> T | LOC_Os11g38140.1 | downstream_gene_variant ; 2282.0bp to feature; MODIFIER | silent_mutation | Average:84.573; most accessible tissue: Minghui63 young leaf, score: 92.158 | N | N | N | N |
| vg1122612595 | C -> T | LOC_Os11g38130-LOC_Os11g38140 | intergenic_region ; MODIFIER | silent_mutation | Average:84.573; most accessible tissue: Minghui63 young leaf, score: 92.158 | N | N | N | N |
| vg1122612595 | C -> DEL | N | N | silent_mutation | Average:84.573; most accessible tissue: Minghui63 young leaf, score: 92.158 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122612595 | NA | 2.22E-08 | mr1100 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122612595 | NA | 3.03E-07 | mr1140 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122612595 | NA | 5.92E-06 | mr1203 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122612595 | NA | 1.64E-06 | mr1395 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122612595 | NA | 2.90E-06 | mr1404 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122612595 | 2.98E-07 | 4.88E-10 | mr1613 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122612595 | NA | 2.58E-06 | mr1618 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122612595 | NA | 7.45E-07 | mr1619 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122612595 | 1.77E-07 | 1.77E-07 | mr1795 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122612595 | 4.67E-06 | 4.26E-09 | mr1913 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122612595 | NA | 1.93E-06 | mr1203_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122612595 | NA | 3.86E-07 | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |