\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122531132:

Variant ID: vg1122531132 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22531132
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


ACTTTTGATAATTATTGATTAATTAGGCTTAAAAAATTCGTCTCGCGGATTAGCTCTCATTTATGAAATTAGTTTTTTTACTAGTCTAGGTTTAATACTC[T/C]
AAATTAGCGTCCAAACATCCGATGTGACATGGGCTAAAAAGTTTTAGCCCCATCTAAACACCCCCTAATGCATTTATGTAGTAAAGATACATCTCACCAT

Reverse complement sequence

ATGGTGAGATGTATCTTTACTACATAAATGCATTAGGGGGTGTTTAGATGGGGCTAAAACTTTTTAGCCCATGTCACATCGGATGTTTGGACGCTAATTT[A/G]
GAGTATTAAACCTAGACTAGTAAAAAAACTAATTTCATAAATGAGAGCTAATCCGCGAGACGAATTTTTTAAGCCTAATTAATCAATAATTATCAAAAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 12.00% 10.10% 0.51% 77.40% NA
All Indica  2759 9.90% 0.60% 0.54% 88.95% NA
All Japonica  1512 17.50% 29.60% 0.53% 52.38% NA
Aus  269 5.60% 0.00% 0.00% 94.42% NA
Indica I  595 1.20% 0.20% 1.34% 97.31% NA
Indica II  465 32.90% 1.30% 0.65% 65.16% NA
Indica III  913 2.50% 0.70% 0.11% 96.71% NA
Indica Intermediate  786 11.60% 0.40% 0.38% 87.66% NA
Temperate Japonica  767 31.70% 11.10% 0.65% 56.58% NA
Tropical Japonica  504 0.40% 57.90% 0.40% 41.27% NA
Japonica Intermediate  241 7.90% 29.50% 0.41% 62.24% NA
VI/Aromatic  96 1.00% 0.00% 0.00% 98.96% NA
Intermediate  90 16.70% 12.20% 1.11% 70.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122531132 T -> DEL N N silent_mutation Average:33.235; most accessible tissue: Zhenshan97 flower, score: 46.765 N N N N
vg1122531132 T -> C LOC_Os11g37990.1 upstream_gene_variant ; 1539.0bp to feature; MODIFIER silent_mutation Average:33.235; most accessible tissue: Zhenshan97 flower, score: 46.765 N N N N
vg1122531132 T -> C LOC_Os11g38000.1 upstream_gene_variant ; 2721.0bp to feature; MODIFIER silent_mutation Average:33.235; most accessible tissue: Zhenshan97 flower, score: 46.765 N N N N
vg1122531132 T -> C LOC_Os11g37990-LOC_Os11g38000 intergenic_region ; MODIFIER silent_mutation Average:33.235; most accessible tissue: Zhenshan97 flower, score: 46.765 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122531132 NA 8.98E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122531132 NA 1.18E-07 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122531132 NA 2.76E-07 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122531132 NA 8.15E-08 mr1405 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122531132 NA 4.55E-06 mr1603 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122531132 NA 2.84E-07 mr1603 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122531132 NA 8.06E-07 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122531132 NA 8.42E-07 mr1817 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122531132 NA 8.19E-12 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122531132 NA 1.45E-06 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122531132 5.96E-07 NA mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122531132 NA 2.98E-10 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122531132 NA 1.05E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122531132 NA 3.70E-09 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251