\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122529329:

Variant ID: vg1122529329 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22529329
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.70, T: 0.30, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:


AACACGTCCTCCACCGAGCCCCTCGGCGGGCGCGGCGGGAGCTCCGGGGGGGAGTAGGAGTAGCCGGAATTGCGGAGGCGGGAGAGGATGAGGGACATGG[C/T]
GGAGCGGGAGGAGGAGCGGCTGGTGCCGAAGGCGGCGTCGTCGTCGGAGTCGGAGGAAGGGGAGGGCTCCGGGCGGAGGTCGAGCGCGGAGGCGGGGCGG

Reverse complement sequence

CCGCCCCGCCTCCGCGCTCGACCTCCGCCCGGAGCCCTCCCCTTCCTCCGACTCCGACGACGACGCCGCCTTCGGCACCAGCCGCTCCTCCTCCCGCTCC[G/A]
CCATGTCCCTCATCCTCTCCCGCCTCCGCAATTCCGGCTACTCCTACTCCCCCCCGGAGCTCCCGCCGCGCCCGCCGAGGGGCTCGGTGGAGGACGTGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.70% 49.00% 0.32% 0.00% NA
All Indica  2759 54.10% 45.60% 0.36% 0.00% NA
All Japonica  1512 48.50% 51.30% 0.26% 0.00% NA
Aus  269 21.90% 78.10% 0.00% 0.00% NA
Indica I  595 84.40% 15.50% 0.17% 0.00% NA
Indica II  465 28.80% 70.80% 0.43% 0.00% NA
Indica III  913 48.10% 51.50% 0.44% 0.00% NA
Indica Intermediate  786 53.10% 46.60% 0.38% 0.00% NA
Temperate Japonica  767 56.30% 43.40% 0.26% 0.00% NA
Tropical Japonica  504 31.50% 68.30% 0.20% 0.00% NA
Japonica Intermediate  241 58.90% 40.70% 0.41% 0.00% NA
VI/Aromatic  96 75.00% 25.00% 0.00% 0.00% NA
Intermediate  90 44.40% 54.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122529329 C -> T LOC_Os11g37990.1 missense_variant ; p.Ala89Thr; MODERATE nonsynonymous_codon ; A89T Average:91.365; most accessible tissue: Zhenshan97 panicle, score: 96.254 unknown unknown TOLERATED 1.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1122529329 C T 0.0 0.01 0.02 0.0 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122529329 NA 4.57E-06 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122529329 NA 1.01E-07 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122529329 NA 1.29E-07 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122529329 NA 2.27E-06 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122529329 4.66E-06 NA mr1761 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122529329 NA 4.38E-06 mr1817 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122529329 NA 8.64E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122529329 NA 2.40E-06 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122529329 NA 4.09E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122529329 NA 1.06E-07 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122529329 NA 5.25E-06 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122529329 NA 1.67E-06 mr1462_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122529329 NA 5.47E-06 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122529329 NA 2.70E-06 mr1719_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122529329 NA 2.52E-06 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122529329 NA 3.74E-06 mr1899_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122529329 NA 8.58E-06 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122529329 NA 5.44E-06 mr1928_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251