Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1122498353:

Variant ID: vg1122498353 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22498353
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, A: 0.07, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


GATATCGGATTTATTTTATACTACAAAACTAAAATTTTAGTTTTGGGACCCGTCTTGGACTCTTAGGCTCTTAGCCGCCATGCTGAAAGGGCCTTACATT[C/A]
TCAACCACTCCCATTCCATATATCTAAAATAAATTATCAACGTTTACTTGTTTGTCCAAAAAAAAAAACTATTGCAAGCCTGCAAAACGCTTGCTCTGAT

Reverse complement sequence

ATCAGAGCAAGCGTTTTGCAGGCTTGCAATAGTTTTTTTTTTTGGACAAACAAGTAAACGTTGATAATTTATTTTAGATATATGGAATGGGAGTGGTTGA[G/T]
AATGTAAGGCCCTTTCAGCATGGCGGCTAAGAGCCTAAGAGTCCAAGACGGGTCCCAAAACTAAAATTTTAGTTTTGTAGTATAAAATAAATCCGATATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.90% 36.40% 2.56% 4.17% NA
All Indica  2759 34.90% 54.70% 3.81% 6.63% NA
All Japonica  1512 95.30% 4.20% 0.20% 0.33% NA
Aus  269 78.80% 15.60% 4.46% 1.12% NA
Indica I  595 15.30% 79.20% 0.84% 4.71% NA
Indica II  465 51.60% 47.10% 0.65% 0.65% NA
Indica III  913 38.60% 41.40% 8.21% 11.83% NA
Indica Intermediate  786 35.60% 56.00% 2.80% 5.60% NA
Temperate Japonica  767 93.10% 6.40% 0.00% 0.52% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 95.00% 3.30% 1.24% 0.41% NA
VI/Aromatic  96 21.90% 75.00% 1.04% 2.08% NA
Intermediate  90 55.60% 40.00% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122498353 C -> A LOC_Os11g37930.1 upstream_gene_variant ; 2805.0bp to feature; MODIFIER silent_mutation Average:70.566; most accessible tissue: Zhenshan97 root, score: 94.61 N N N N
vg1122498353 C -> A LOC_Os11g37940.1 upstream_gene_variant ; 145.0bp to feature; MODIFIER silent_mutation Average:70.566; most accessible tissue: Zhenshan97 root, score: 94.61 N N N N
vg1122498353 C -> A LOC_Os11g37950.1 upstream_gene_variant ; 3654.0bp to feature; MODIFIER silent_mutation Average:70.566; most accessible tissue: Zhenshan97 root, score: 94.61 N N N N
vg1122498353 C -> A LOC_Os11g37944.1 downstream_gene_variant ; 2179.0bp to feature; MODIFIER silent_mutation Average:70.566; most accessible tissue: Zhenshan97 root, score: 94.61 N N N N
vg1122498353 C -> A LOC_Os11g37930-LOC_Os11g37940 intergenic_region ; MODIFIER silent_mutation Average:70.566; most accessible tissue: Zhenshan97 root, score: 94.61 N N N N
vg1122498353 C -> DEL N N silent_mutation Average:70.566; most accessible tissue: Zhenshan97 root, score: 94.61 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1122498353 C A 0.05 -0.04 -0.03 -0.02 -0.04 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122498353 NA 7.55E-06 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122498353 NA 1.72E-06 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122498353 NA 3.87E-06 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122498353 NA 3.92E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122498353 NA 4.53E-09 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122498353 NA 5.61E-06 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122498353 NA 1.22E-11 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122498353 NA 6.76E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122498353 NA 9.11E-07 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122498353 NA 4.98E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122498353 NA 1.33E-09 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122498353 NA 1.94E-07 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122498353 NA 1.06E-06 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122498353 NA 5.77E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122498353 NA 2.48E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122498353 NA 8.14E-08 mr1402_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122498353 NA 8.50E-06 mr1462_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122498353 NA 6.43E-11 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122498353 NA 1.77E-06 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122498353 NA 5.85E-07 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122498353 8.40E-08 9.40E-15 mr1913_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122498353 NA 2.51E-08 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122498353 NA 4.05E-06 mr1994_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251