Variant ID: vg1122487776 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 22487776 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 318. )
TTTCATACTTAGTGCTGCATCAGTTAAGTTTGATCTACTAAGTCGTGCTTAGAACCATAATCTCTAGCCTGCTTATTGACTGCCAATAAGGGTTTCATCG[G/A]
GGTTTCAGCCGATGAATTATCTAGACGTTGCATCGGCTTATAAGGATTGTATACATATTGGATTTAGCCGATCGCAACAAAGATTTTATCGTTTAATCTA
TAGATTAAACGATAAAATCTTTGTTGCGATCGGCTAAATCCAATATGTATACAATCCTTATAAGCCGATGCAACGTCTAGATAATTCATCGGCTGAAACC[C/T]
CGATGAAACCCTTATTGGCAGTCAATAAGCAGGCTAGAGATTATGGTTCTAAGCACGACTTAGTAGATCAAACTTAACTGATGCAGCACTAAGTATGAAA
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
All Indica | 2759 | 94.70% | 5.30% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Indica II | 465 | 82.60% | 17.40% | 0.00% | 0.00% | NA |
Indica III | 913 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 93.60% | 6.40% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1122487776 | G -> A | LOC_Os11g37910.1 | upstream_gene_variant ; 1387.0bp to feature; MODIFIER | silent_mutation | Average:40.098; most accessible tissue: Zhenshan97 flag leaf, score: 58.772 | N | N | N | N |
vg1122487776 | G -> A | LOC_Os11g37920.1 | upstream_gene_variant ; 3642.0bp to feature; MODIFIER | silent_mutation | Average:40.098; most accessible tissue: Zhenshan97 flag leaf, score: 58.772 | N | N | N | N |
vg1122487776 | G -> A | LOC_Os11g37900-LOC_Os11g37910 | intergenic_region ; MODIFIER | silent_mutation | Average:40.098; most accessible tissue: Zhenshan97 flag leaf, score: 58.772 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1122487776 | NA | 2.51E-06 | mr1122 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1122487776 | 1.61E-06 | 2.08E-09 | mr1310 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1122487776 | NA | 2.33E-06 | mr1525 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1122487776 | NA | 9.01E-06 | mr1720 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1122487776 | 3.86E-07 | 3.08E-12 | mr1889 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1122487776 | 1.12E-07 | 1.08E-10 | mr1896 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1122487776 | NA | 1.47E-09 | mr1903 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1122487776 | 5.25E-06 | 8.45E-14 | mr1907 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1122487776 | 1.38E-06 | 1.38E-06 | mr1926 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1122487776 | 4.96E-07 | 7.73E-14 | mr1934 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1122487776 | NA | 1.28E-08 | mr1935 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1122487776 | NA | 2.12E-06 | mr1322_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |