\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122487776:

Variant ID: vg1122487776 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22487776
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCATACTTAGTGCTGCATCAGTTAAGTTTGATCTACTAAGTCGTGCTTAGAACCATAATCTCTAGCCTGCTTATTGACTGCCAATAAGGGTTTCATCG[G/A]
GGTTTCAGCCGATGAATTATCTAGACGTTGCATCGGCTTATAAGGATTGTATACATATTGGATTTAGCCGATCGCAACAAAGATTTTATCGTTTAATCTA

Reverse complement sequence

TAGATTAAACGATAAAATCTTTGTTGCGATCGGCTAAATCCAATATGTATACAATCCTTATAAGCCGATGCAACGTCTAGATAATTCATCGGCTGAAACC[C/T]
CGATGAAACCCTTATTGGCAGTCAATAAGCAGGCTAGAGATTATGGTTCTAAGCACGACTTAGTAGATCAAACTTAACTGATGCAGCACTAAGTATGAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.80% 3.20% 0.00% 0.00% NA
All Indica  2759 94.70% 5.30% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 82.60% 17.40% 0.00% 0.00% NA
Indica III  913 98.60% 1.40% 0.00% 0.00% NA
Indica Intermediate  786 93.60% 6.40% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122487776 G -> A LOC_Os11g37910.1 upstream_gene_variant ; 1387.0bp to feature; MODIFIER silent_mutation Average:40.098; most accessible tissue: Zhenshan97 flag leaf, score: 58.772 N N N N
vg1122487776 G -> A LOC_Os11g37920.1 upstream_gene_variant ; 3642.0bp to feature; MODIFIER silent_mutation Average:40.098; most accessible tissue: Zhenshan97 flag leaf, score: 58.772 N N N N
vg1122487776 G -> A LOC_Os11g37900-LOC_Os11g37910 intergenic_region ; MODIFIER silent_mutation Average:40.098; most accessible tissue: Zhenshan97 flag leaf, score: 58.772 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122487776 NA 2.51E-06 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487776 1.61E-06 2.08E-09 mr1310 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487776 NA 2.33E-06 mr1525 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487776 NA 9.01E-06 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487776 3.86E-07 3.08E-12 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487776 1.12E-07 1.08E-10 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487776 NA 1.47E-09 mr1903 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487776 5.25E-06 8.45E-14 mr1907 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487776 1.38E-06 1.38E-06 mr1926 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487776 4.96E-07 7.73E-14 mr1934 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487776 NA 1.28E-08 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122487776 NA 2.12E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251