Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1122457949:

Variant ID: vg1122457949 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22457949
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAATAGTTTATTGTAAAATCACTATTGGTTCCATTGGAAGGTATGAAACCTGTTTGGGTAGGACTAATTTTTTTTAGCTACCCCAACAATCCAATTAATC[G/A]
CAACCTTGGTAAAAATATTAAAACTCACCATATAATAAACAGATCAGCTTATATTGCTCAATCTTAAAAGCCTCTTTACATTTAGACAATAAAATAATTG

Reverse complement sequence

CAATTATTTTATTGTCTAAATGTAAAGAGGCTTTTAAGATTGAGCAATATAAGCTGATCTGTTTATTATATGGTGAGTTTTAATATTTTTACCAAGGTTG[C/T]
GATTAATTGGATTGTTGGGGTAGCTAAAAAAAATTAGTCCTACCCAAACAGGTTTCATACCTTCCAATGGAACCAATAGTGATTTTACAATAAACTATTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.40%	10.70%	0.83%	3.00%	NA
All Indica	2759	93.40%	0.30%	1.34%	4.89%	NA
All Japonica	1512	67.50%	32.20%	0.07%	0.26%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	95.50%	0.00%	1.01%	3.53%	NA
Indica II	465	98.50%	0.60%	0.00%	0.86%	NA
Indica III	913	88.70%	0.00%	2.74%	8.54%	NA
Indica Intermediate	786	94.40%	0.80%	0.76%	4.07%	NA
Temperate Japonica	767	78.10%	21.40%	0.00%	0.52%	NA
Tropical Japonica	504	63.10%	36.70%	0.20%	0.00%	NA
Japonica Intermediate	241	42.70%	57.30%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	13.30%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122457949	G -> A	LOC_Os11g37890.1	downstream_gene_variant ; 1851.0bp to feature; MODIFIER	silent_mutation	Average:46.359; most accessible tissue: Callus, score: 90.895	N	N	N	N
vg1122457949	G -> A	LOC_Os11g37890.3	downstream_gene_variant ; 1851.0bp to feature; MODIFIER	silent_mutation	Average:46.359; most accessible tissue: Callus, score: 90.895	N	N	N	N
vg1122457949	G -> A	LOC_Os11g37890.2	downstream_gene_variant ; 3096.0bp to feature; MODIFIER	silent_mutation	Average:46.359; most accessible tissue: Callus, score: 90.895	N	N	N	N
vg1122457949	G -> A	LOC_Os11g37880.1	intron_variant ; MODIFIER	silent_mutation	Average:46.359; most accessible tissue: Callus, score: 90.895	N	N	N	N
vg1122457949	G -> DEL	N	N	silent_mutation	Average:46.359; most accessible tissue: Callus, score: 90.895	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122457949	5.48E-09	3.49E-12	mr1662	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122457949	5.17E-06	5.60E-08	mr1662	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122457949	NA	1.01E-06	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122457949	NA	4.13E-08	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251