\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122427075:

Variant ID: vg1122427075 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22427075
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 65. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTAATGCATTTTGCATATAATTTTATTTGCGATGTCAATACATGTAGTGGGTTGGAGCTCGTTTAAATATGCATGACATCCATAACAAGTTCAGGATC[C/T]
AAAAATATATTTCGAGAGTTCACTAAACTAGATGATACATACGCACAAGTTTAGATACCACTCGTAAATAGATACATACAGCCAAAACCATGAAAACATA

Reverse complement sequence

TATGTTTTCATGGTTTTGGCTGTATGTATCTATTTACGAGTGGTATCTAAACTTGTGCGTATGTATCATCTAGTTTAGTGAACTCTCGAAATATATTTTT[G/A]
GATCCTGAACTTGTTATGGATGTCATGCATATTTAAACGAGCTCCAACCCACTACATGTATTGACATCGCAAATAAAATTATATGCAAAATGCATTAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.10% 39.70% 0.08% 5.14% NA
All Indica  2759 36.00% 58.50% 0.11% 5.40% NA
All Japonica  1512 92.90% 2.90% 0.07% 4.17% NA
Aus  269 26.80% 63.60% 0.00% 9.67% NA
Indica I  595 19.30% 75.50% 0.17% 5.04% NA
Indica II  465 48.20% 49.70% 0.43% 1.72% NA
Indica III  913 40.00% 51.20% 0.00% 8.87% NA
Indica Intermediate  786 36.90% 59.30% 0.00% 3.82% NA
Temperate Japonica  767 94.70% 2.70% 0.13% 2.48% NA
Tropical Japonica  504 88.90% 3.20% 0.00% 7.94% NA
Japonica Intermediate  241 95.40% 2.90% 0.00% 1.66% NA
VI/Aromatic  96 85.40% 13.50% 0.00% 1.04% NA
Intermediate  90 57.80% 37.80% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122427075 C -> T LOC_Os11g37860.1 upstream_gene_variant ; 684.0bp to feature; MODIFIER silent_mutation Average:39.677; most accessible tissue: Callus, score: 83.438 N N N N
vg1122427075 C -> T LOC_Os11g37850.1 downstream_gene_variant ; 2207.0bp to feature; MODIFIER silent_mutation Average:39.677; most accessible tissue: Callus, score: 83.438 N N N N
vg1122427075 C -> T LOC_Os11g37850-LOC_Os11g37860 intergenic_region ; MODIFIER silent_mutation Average:39.677; most accessible tissue: Callus, score: 83.438 N N N N
vg1122427075 C -> DEL N N silent_mutation Average:39.677; most accessible tissue: Callus, score: 83.438 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122427075 NA 6.01E-06 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122427075 NA 2.43E-06 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122427075 9.56E-06 5.86E-07 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122427075 NA 8.35E-06 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122427075 8.32E-06 8.32E-06 mr1234 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122427075 3.44E-10 3.44E-10 mr1237 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122427075 9.69E-07 3.77E-07 mr1517 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122427075 2.38E-06 2.38E-06 mr1526 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122427075 2.76E-06 3.90E-06 mr1538 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122427075 6.22E-06 6.22E-06 mr1581 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122427075 5.03E-07 1.35E-08 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122427075 NA 4.07E-06 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122427075 3.54E-06 3.70E-06 mr1737 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122427075 3.16E-09 3.16E-09 mr1795 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122427075 NA 5.69E-06 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122427075 6.63E-06 1.31E-06 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122427075 5.69E-07 5.69E-07 mr1970 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122427075 2.23E-06 2.23E-06 mr1973 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122427075 NA 1.31E-08 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251