| Variant ID: vg1122413063 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22413063 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCCTTCTCTAAAAAAAATAAAAAATAAAAAAAAGATGGTGGCAGGAGGCAGCCATCATGGCATCTGAATCTTGAGAACTAGCACTGAAGCAGTAAACCAT[A/T]
CTCGGTTGGATATAGTGGCCGGGTAAAAAAAATACCCTTCTCTAAAAAAATAAAAAAAATGGTGGCGGGACGCAGCCATCATGGCATCTGAATCTTGAGA
TCTCAAGATTCAGATGCCATGATGGCTGCGTCCCGCCACCATTTTTTTTATTTTTTTAGAGAAGGGTATTTTTTTTACCCGGCCACTATATCCAACCGAG[T/A]
ATGGTTTACTGCTTCAGTGCTAGTTCTCAAGATTCAGATGCCATGATGGCTGCCTCCTGCCACCATCTTTTTTTTATTTTTTATTTTTTTTAGAGAAGGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.50% | 1.40% | 8.84% | 49.24% | NA |
| All Indica | 2759 | 25.80% | 0.00% | 11.13% | 63.03% | NA |
| All Japonica | 1512 | 68.40% | 4.10% | 5.36% | 22.16% | NA |
| Aus | 269 | 16.40% | 0.00% | 8.55% | 75.09% | NA |
| Indica I | 595 | 26.10% | 0.00% | 25.38% | 48.57% | NA |
| Indica II | 465 | 12.70% | 0.00% | 13.55% | 73.76% | NA |
| Indica III | 913 | 36.90% | 0.00% | 0.44% | 62.65% | NA |
| Indica Intermediate | 786 | 20.50% | 0.10% | 11.32% | 68.07% | NA |
| Temperate Japonica | 767 | 82.50% | 1.30% | 5.61% | 10.56% | NA |
| Tropical Japonica | 504 | 50.00% | 9.30% | 3.57% | 37.10% | NA |
| Japonica Intermediate | 241 | 61.80% | 2.10% | 8.30% | 27.80% | NA |
| VI/Aromatic | 96 | 84.40% | 0.00% | 1.04% | 14.58% | NA |
| Intermediate | 90 | 47.80% | 4.40% | 6.67% | 41.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122413063 | A -> T | LOC_Os11g37840.1 | upstream_gene_variant ; 439.0bp to feature; MODIFIER | silent_mutation | Average:45.196; most accessible tissue: Callus, score: 66.122 | N | N | N | N |
| vg1122413063 | A -> T | LOC_Os11g37830-LOC_Os11g37840 | intergenic_region ; MODIFIER | silent_mutation | Average:45.196; most accessible tissue: Callus, score: 66.122 | N | N | N | N |
| vg1122413063 | A -> DEL | N | N | silent_mutation | Average:45.196; most accessible tissue: Callus, score: 66.122 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122413063 | NA | 9.25E-06 | mr1095 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122413063 | 7.07E-06 | 3.78E-06 | mr1101 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122413063 | 5.05E-06 | NA | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122413063 | 2.94E-06 | 7.29E-06 | mr1917 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122413063 | 4.90E-06 | 4.90E-06 | mr1918 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122413063 | 6.38E-06 | NA | mr1936 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122413063 | NA | 3.26E-06 | mr1961 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |