Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122365067:

Variant ID: vg1122365067 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22365067
Reference Allele: A	Alternative Allele: T,C
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATTTATGAGAGATCCTAGGATAGAGTCCGACTCTTACTCTAGTCCTAATACCTATTAAACTGTAACCGACTACGTACACATATTCGACATAAACTCTAA[A/T,C]
AATAAATTTGCCATTGCCACTGCCTTTCTAATTTGCTGGTTAAATTGCTGCTGCGATGCTCTAGTACATGATGGATCACACCACAATTCACTCATTAACT

Reverse complement sequence

AGTTAATGAGTGAATTGTGGTGTGATCCATCATGTACTAGAGCATCGCAGCAGCAATTTAACCAGCAAATTAGAAAGGCAGTGGCAATGGCAAATTTATT[T/A,G]
TTAGAGTTTATGTCGAATATGTGTACGTAGTCGGTTACAGTTTAATAGGTATTAGGACTAGAGTAAGAGTCGGACTCTATCCTAGGATCTCTCATAAATA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.90%	26.60%	1.90%	5.48%	C: 0.13%
All Indica	2759	76.30%	22.10%	0.98%	0.62%	NA
All Japonica	1512	53.60%	33.50%	1.79%	11.04%	C: 0.07%
Aus	269	42.00%	20.40%	12.27%	25.28%	NA
Indica I	595	82.50%	11.80%	3.36%	2.35%	NA
Indica II	465	96.10%	3.40%	0.00%	0.43%	NA
Indica III	913	55.10%	44.80%	0.00%	0.11%	NA
Indica Intermediate	786	84.60%	14.50%	0.89%	0.00%	NA
Temperate Japonica	767	76.30%	19.20%	0.39%	4.17%	NA
Tropical Japonica	504	27.60%	48.60%	2.98%	20.83%	NA
Japonica Intermediate	241	35.70%	47.70%	3.73%	12.45%	C: 0.41%
VI/Aromatic	96	25.00%	63.50%	2.08%	4.17%	C: 5.21%
Intermediate	90	66.70%	28.90%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122365067	A -> T	LOC_Os11g37780.1	upstream_gene_variant ; 1911.0bp to feature; MODIFIER	silent_mutation	Average:54.902; most accessible tissue: Callus, score: 72.743	N	N	N	N
vg1122365067	A -> T	LOC_Os11g37774-LOC_Os11g37780	intergenic_region ; MODIFIER	silent_mutation	Average:54.902; most accessible tissue: Callus, score: 72.743	N	N	N	N
vg1122365067	A -> DEL	N	N	silent_mutation	Average:54.902; most accessible tissue: Callus, score: 72.743	N	N	N	N
vg1122365067	A -> C	LOC_Os11g37780.1	upstream_gene_variant ; 1911.0bp to feature; MODIFIER	silent_mutation	Average:54.902; most accessible tissue: Callus, score: 72.743	N	N	N	N
vg1122365067	A -> C	LOC_Os11g37774-LOC_Os11g37780	intergenic_region ; MODIFIER	silent_mutation	Average:54.902; most accessible tissue: Callus, score: 72.743	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122365067	NA	1.67E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067	1.34E-06	1.34E-06	mr1060	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067	NA	2.96E-06	mr1205	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067	NA	6.65E-06	mr1338	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067	NA	2.47E-06	mr1359	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067	NA	3.76E-06	mr1380	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067	4.72E-06	4.72E-06	mr1393	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067	2.00E-06	2.00E-06	mr1520	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067	NA	6.73E-09	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067	NA	8.48E-09	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067	NA	6.83E-07	mr1576	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067	NA	6.81E-06	mr1614	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067	NA	1.77E-06	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067	NA	3.67E-07	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067	NA	6.42E-07	mr1741	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067	NA	1.66E-07	mr1763	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067	NA	1.84E-06	mr1937	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067	3.54E-07	3.54E-07	mr1996	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251