\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122365067:

Variant ID: vg1122365067 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22365067
Reference Allele: AAlternative Allele: T,C
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATTTATGAGAGATCCTAGGATAGAGTCCGACTCTTACTCTAGTCCTAATACCTATTAAACTGTAACCGACTACGTACACATATTCGACATAAACTCTAA[A/T,C]
AATAAATTTGCCATTGCCACTGCCTTTCTAATTTGCTGGTTAAATTGCTGCTGCGATGCTCTAGTACATGATGGATCACACCACAATTCACTCATTAACT

Reverse complement sequence

AGTTAATGAGTGAATTGTGGTGTGATCCATCATGTACTAGAGCATCGCAGCAGCAATTTAACCAGCAAATTAGAAAGGCAGTGGCAATGGCAAATTTATT[T/A,G]
TTAGAGTTTATGTCGAATATGTGTACGTAGTCGGTTACAGTTTAATAGGTATTAGGACTAGAGTAAGAGTCGGACTCTATCCTAGGATCTCTCATAAATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.90% 26.60% 1.90% 5.48% C: 0.13%
All Indica  2759 76.30% 22.10% 0.98% 0.62% NA
All Japonica  1512 53.60% 33.50% 1.79% 11.04% C: 0.07%
Aus  269 42.00% 20.40% 12.27% 25.28% NA
Indica I  595 82.50% 11.80% 3.36% 2.35% NA
Indica II  465 96.10% 3.40% 0.00% 0.43% NA
Indica III  913 55.10% 44.80% 0.00% 0.11% NA
Indica Intermediate  786 84.60% 14.50% 0.89% 0.00% NA
Temperate Japonica  767 76.30% 19.20% 0.39% 4.17% NA
Tropical Japonica  504 27.60% 48.60% 2.98% 20.83% NA
Japonica Intermediate  241 35.70% 47.70% 3.73% 12.45% C: 0.41%
VI/Aromatic  96 25.00% 63.50% 2.08% 4.17% C: 5.21%
Intermediate  90 66.70% 28.90% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122365067 A -> T LOC_Os11g37780.1 upstream_gene_variant ; 1911.0bp to feature; MODIFIER silent_mutation Average:54.902; most accessible tissue: Callus, score: 72.743 N N N N
vg1122365067 A -> T LOC_Os11g37774-LOC_Os11g37780 intergenic_region ; MODIFIER silent_mutation Average:54.902; most accessible tissue: Callus, score: 72.743 N N N N
vg1122365067 A -> DEL N N silent_mutation Average:54.902; most accessible tissue: Callus, score: 72.743 N N N N
vg1122365067 A -> C LOC_Os11g37780.1 upstream_gene_variant ; 1911.0bp to feature; MODIFIER silent_mutation Average:54.902; most accessible tissue: Callus, score: 72.743 N N N N
vg1122365067 A -> C LOC_Os11g37774-LOC_Os11g37780 intergenic_region ; MODIFIER silent_mutation Average:54.902; most accessible tissue: Callus, score: 72.743 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122365067 NA 1.67E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067 1.34E-06 1.34E-06 mr1060 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067 NA 2.96E-06 mr1205 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067 NA 6.65E-06 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067 NA 2.47E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067 NA 3.76E-06 mr1380 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067 4.72E-06 4.72E-06 mr1393 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067 2.00E-06 2.00E-06 mr1520 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067 NA 6.73E-09 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067 NA 8.48E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067 NA 6.83E-07 mr1576 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067 NA 6.81E-06 mr1614 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067 NA 1.77E-06 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067 NA 3.67E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067 NA 6.42E-07 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067 NA 1.66E-07 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067 NA 1.84E-06 mr1937 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122365067 3.54E-07 3.54E-07 mr1996 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251