Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1122328656:

Variant ID: vg1122328656 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22328656
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATATAATAGATAGATAGATAGTTACATACTACACTATCAATAGCTGGTCCCATCTGTCATACACACACTGCGTCTTGGAGTCCGTACTATAGCTGGCTA[C/T]
AAATCAGTAACCCGCTGCTCTTCTCTCTCCTCATTTATCTTCTTAAAATATGTTTGCAGCTGGTTTATAGCCTGCTATTGTACCTGCTCTCAGATGTGCA

Reverse complement sequence

TGCACATCTGAGAGCAGGTACAATAGCAGGCTATAAACCAGCTGCAAACATATTTTAAGAAGATAAATGAGGAGAGAGAAGAGCAGCGGGTTACTGATTT[G/A]
TAGCCAGCTATAGTACGGACTCCAAGACGCAGTGTGTGTATGACAGATGGGACCAGCTATTGATAGTGTAGTATGTAACTATCTATCTATCTATTATATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.20%	5.40%	9.71%	36.65%	NA
All Indica	2759	40.10%	0.40%	14.46%	45.05%	NA
All Japonica	1512	65.60%	11.70%	0.86%	21.83%	NA
Aus	269	40.10%	0.40%	14.13%	45.35%	NA
Indica I	595	36.60%	0.00%	19.50%	43.87%	NA
Indica II	465	26.70%	0.20%	16.99%	56.13%	NA
Indica III	913	53.00%	0.70%	9.20%	37.13%	NA
Indica Intermediate	786	35.80%	0.40%	15.27%	48.60%	NA
Temperate Japonica	767	77.70%	11.00%	0.78%	10.56%	NA
Tropical Japonica	504	59.90%	6.50%	0.99%	32.54%	NA
Japonica Intermediate	241	39.00%	24.90%	0.83%	35.27%	NA
VI/Aromatic	96	32.30%	56.20%	3.12%	8.33%	NA
Intermediate	90	46.70%	14.40%	6.67%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122328656	C -> T	LOC_Os11g37759.1	upstream_gene_variant ; 311.0bp to feature; MODIFIER	silent_mutation	Average:19.542; most accessible tissue: Callus, score: 81.188	N	N	N	N
vg1122328656	C -> T	LOC_Os11g37759.3	upstream_gene_variant ; 311.0bp to feature; MODIFIER	silent_mutation	Average:19.542; most accessible tissue: Callus, score: 81.188	N	N	N	N
vg1122328656	C -> T	LOC_Os11g37759.2	upstream_gene_variant ; 311.0bp to feature; MODIFIER	silent_mutation	Average:19.542; most accessible tissue: Callus, score: 81.188	N	N	N	N
vg1122328656	C -> T	LOC_Os11g37750.1	downstream_gene_variant ; 3667.0bp to feature; MODIFIER	silent_mutation	Average:19.542; most accessible tissue: Callus, score: 81.188	N	N	N	N
vg1122328656	C -> T	LOC_Os11g37750-LOC_Os11g37759	intergenic_region ; MODIFIER	silent_mutation	Average:19.542; most accessible tissue: Callus, score: 81.188	N	N	N	N
vg1122328656	C -> DEL	N	N	silent_mutation	Average:19.542; most accessible tissue: Callus, score: 81.188	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122328656	NA	6.13E-11	mr1070	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122328656	NA	4.41E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122328656	NA	7.96E-06	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122328656	NA	1.52E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122328656	NA	4.73E-09	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122328656	8.42E-06	6.26E-07	mr1640	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122328656	5.45E-06	5.44E-06	mr1849	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122328656	1.12E-06	NA	mr1917	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251