\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122328656:

Variant ID: vg1122328656 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22328656
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATATAATAGATAGATAGATAGTTACATACTACACTATCAATAGCTGGTCCCATCTGTCATACACACACTGCGTCTTGGAGTCCGTACTATAGCTGGCTA[C/T]
AAATCAGTAACCCGCTGCTCTTCTCTCTCCTCATTTATCTTCTTAAAATATGTTTGCAGCTGGTTTATAGCCTGCTATTGTACCTGCTCTCAGATGTGCA

Reverse complement sequence

TGCACATCTGAGAGCAGGTACAATAGCAGGCTATAAACCAGCTGCAAACATATTTTAAGAAGATAAATGAGGAGAGAGAAGAGCAGCGGGTTACTGATTT[G/A]
TAGCCAGCTATAGTACGGACTCCAAGACGCAGTGTGTGTATGACAGATGGGACCAGCTATTGATAGTGTAGTATGTAACTATCTATCTATCTATTATATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.20% 5.40% 9.71% 36.65% NA
All Indica  2759 40.10% 0.40% 14.46% 45.05% NA
All Japonica  1512 65.60% 11.70% 0.86% 21.83% NA
Aus  269 40.10% 0.40% 14.13% 45.35% NA
Indica I  595 36.60% 0.00% 19.50% 43.87% NA
Indica II  465 26.70% 0.20% 16.99% 56.13% NA
Indica III  913 53.00% 0.70% 9.20% 37.13% NA
Indica Intermediate  786 35.80% 0.40% 15.27% 48.60% NA
Temperate Japonica  767 77.70% 11.00% 0.78% 10.56% NA
Tropical Japonica  504 59.90% 6.50% 0.99% 32.54% NA
Japonica Intermediate  241 39.00% 24.90% 0.83% 35.27% NA
VI/Aromatic  96 32.30% 56.20% 3.12% 8.33% NA
Intermediate  90 46.70% 14.40% 6.67% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122328656 C -> T LOC_Os11g37759.1 upstream_gene_variant ; 311.0bp to feature; MODIFIER silent_mutation Average:19.542; most accessible tissue: Callus, score: 81.188 N N N N
vg1122328656 C -> T LOC_Os11g37759.3 upstream_gene_variant ; 311.0bp to feature; MODIFIER silent_mutation Average:19.542; most accessible tissue: Callus, score: 81.188 N N N N
vg1122328656 C -> T LOC_Os11g37759.2 upstream_gene_variant ; 311.0bp to feature; MODIFIER silent_mutation Average:19.542; most accessible tissue: Callus, score: 81.188 N N N N
vg1122328656 C -> T LOC_Os11g37750.1 downstream_gene_variant ; 3667.0bp to feature; MODIFIER silent_mutation Average:19.542; most accessible tissue: Callus, score: 81.188 N N N N
vg1122328656 C -> T LOC_Os11g37750-LOC_Os11g37759 intergenic_region ; MODIFIER silent_mutation Average:19.542; most accessible tissue: Callus, score: 81.188 N N N N
vg1122328656 C -> DEL N N silent_mutation Average:19.542; most accessible tissue: Callus, score: 81.188 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122328656 NA 6.13E-11 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122328656 NA 4.41E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122328656 NA 7.96E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122328656 NA 1.52E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122328656 NA 4.73E-09 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122328656 8.42E-06 6.26E-07 mr1640 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122328656 5.45E-06 5.44E-06 mr1849 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122328656 1.12E-06 NA mr1917 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251