\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122183927:

Variant ID: vg1122183927 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22183927
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTCTTTCTCCTCAAGCTAGCACTTATAGAAACAACGTAAACTAGACTTTAAAACACTCATAAAATTTTAAATCATATATTCATTTATGATATTTCTACA[C/T]
TATTGTAATTTTCAATTAAATCAATAATTTAATATCTGTATTGACTTACATTGTGGACCATATCTATCCATCTTTAAGCCTCCAATAAATAAAATAGAAT

Reverse complement sequence

ATTCTATTTTATTTATTGGAGGCTTAAAGATGGATAGATATGGTCCACAATGTAAGTCAATACAGATATTAAATTATTGATTTAATTGAAAATTACAATA[G/A]
TGTAGAAATATCATAAATGAATATATGATTTAAAATTTTATGAGTGTTTTAAAGTCTAGTTTACGTTGTTTCTATAAGTGCTAGCTTGAGGAGAAAGAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.30% 0.50% 20.74% 22.45% NA
All Indica  2759 35.00% 0.70% 30.63% 33.60% NA
All Japonica  1512 93.80% 0.10% 0.99% 5.03% NA
Aus  269 68.00% 0.40% 30.11% 1.49% NA
Indica I  595 38.80% 1.80% 26.22% 33.11% NA
Indica II  465 10.50% 0.00% 34.62% 54.84% NA
Indica III  913 46.40% 0.40% 29.68% 23.44% NA
Indica Intermediate  786 33.50% 0.60% 32.70% 33.21% NA
Temperate Japonica  767 94.80% 0.30% 0.78% 4.17% NA
Tropical Japonica  504 94.60% 0.00% 0.60% 4.76% NA
Japonica Intermediate  241 89.20% 0.00% 2.49% 8.30% NA
VI/Aromatic  96 43.80% 0.00% 23.96% 32.29% NA
Intermediate  90 56.70% 0.00% 17.78% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122183927 C -> T LOC_Os11g37570.1 upstream_gene_variant ; 2371.0bp to feature; MODIFIER silent_mutation Average:14.294; most accessible tissue: Callus, score: 33.479 N N N N
vg1122183927 C -> T LOC_Os11g37580.1 downstream_gene_variant ; 2537.0bp to feature; MODIFIER silent_mutation Average:14.294; most accessible tissue: Callus, score: 33.479 N N N N
vg1122183927 C -> T LOC_Os11g37570-LOC_Os11g37580 intergenic_region ; MODIFIER silent_mutation Average:14.294; most accessible tissue: Callus, score: 33.479 N N N N
vg1122183927 C -> DEL N N silent_mutation Average:14.294; most accessible tissue: Callus, score: 33.479 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122183927 9.72E-06 NA mr1489_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251