Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1122183927:

Variant ID: vg1122183927 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22183927
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTCTTTCTCCTCAAGCTAGCACTTATAGAAACAACGTAAACTAGACTTTAAAACACTCATAAAATTTTAAATCATATATTCATTTATGATATTTCTACA[C/T]
TATTGTAATTTTCAATTAAATCAATAATTTAATATCTGTATTGACTTACATTGTGGACCATATCTATCCATCTTTAAGCCTCCAATAAATAAAATAGAAT

Reverse complement sequence

ATTCTATTTTATTTATTGGAGGCTTAAAGATGGATAGATATGGTCCACAATGTAAGTCAATACAGATATTAAATTATTGATTTAATTGAAAATTACAATA[G/A]
TGTAGAAATATCATAAATGAATATATGATTTAAAATTTTATGAGTGTTTTAAAGTCTAGTTTACGTTGTTTCTATAAGTGCTAGCTTGAGGAGAAAGAGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.30%	0.50%	20.74%	22.45%	NA
All Indica	2759	35.00%	0.70%	30.63%	33.60%	NA
All Japonica	1512	93.80%	0.10%	0.99%	5.03%	NA
Aus	269	68.00%	0.40%	30.11%	1.49%	NA
Indica I	595	38.80%	1.80%	26.22%	33.11%	NA
Indica II	465	10.50%	0.00%	34.62%	54.84%	NA
Indica III	913	46.40%	0.40%	29.68%	23.44%	NA
Indica Intermediate	786	33.50%	0.60%	32.70%	33.21%	NA
Temperate Japonica	767	94.80%	0.30%	0.78%	4.17%	NA
Tropical Japonica	504	94.60%	0.00%	0.60%	4.76%	NA
Japonica Intermediate	241	89.20%	0.00%	2.49%	8.30%	NA
VI/Aromatic	96	43.80%	0.00%	23.96%	32.29%	NA
Intermediate	90	56.70%	0.00%	17.78%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122183927	C -> T	LOC_Os11g37570.1	upstream_gene_variant ; 2371.0bp to feature; MODIFIER	silent_mutation	Average:14.294; most accessible tissue: Callus, score: 33.479	N	N	N	N
vg1122183927	C -> T	LOC_Os11g37580.1	downstream_gene_variant ; 2537.0bp to feature; MODIFIER	silent_mutation	Average:14.294; most accessible tissue: Callus, score: 33.479	N	N	N	N
vg1122183927	C -> T	LOC_Os11g37570-LOC_Os11g37580	intergenic_region ; MODIFIER	silent_mutation	Average:14.294; most accessible tissue: Callus, score: 33.479	N	N	N	N
vg1122183927	C -> DEL	N	N	silent_mutation	Average:14.294; most accessible tissue: Callus, score: 33.479	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122183927	9.72E-06	NA	mr1489_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251