Variant ID: vg1122183927 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 22183927 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCTCTTTCTCCTCAAGCTAGCACTTATAGAAACAACGTAAACTAGACTTTAAAACACTCATAAAATTTTAAATCATATATTCATTTATGATATTTCTACA[C/T]
TATTGTAATTTTCAATTAAATCAATAATTTAATATCTGTATTGACTTACATTGTGGACCATATCTATCCATCTTTAAGCCTCCAATAAATAAAATAGAAT
ATTCTATTTTATTTATTGGAGGCTTAAAGATGGATAGATATGGTCCACAATGTAAGTCAATACAGATATTAAATTATTGATTTAATTGAAAATTACAATA[G/A]
TGTAGAAATATCATAAATGAATATATGATTTAAAATTTTATGAGTGTTTTAAAGTCTAGTTTACGTTGTTTCTATAAGTGCTAGCTTGAGGAGAAAGAGA
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 56.30% | 0.50% | 20.74% | 22.45% | NA |
All Indica | 2759 | 35.00% | 0.70% | 30.63% | 33.60% | NA |
All Japonica | 1512 | 93.80% | 0.10% | 0.99% | 5.03% | NA |
Aus | 269 | 68.00% | 0.40% | 30.11% | 1.49% | NA |
Indica I | 595 | 38.80% | 1.80% | 26.22% | 33.11% | NA |
Indica II | 465 | 10.50% | 0.00% | 34.62% | 54.84% | NA |
Indica III | 913 | 46.40% | 0.40% | 29.68% | 23.44% | NA |
Indica Intermediate | 786 | 33.50% | 0.60% | 32.70% | 33.21% | NA |
Temperate Japonica | 767 | 94.80% | 0.30% | 0.78% | 4.17% | NA |
Tropical Japonica | 504 | 94.60% | 0.00% | 0.60% | 4.76% | NA |
Japonica Intermediate | 241 | 89.20% | 0.00% | 2.49% | 8.30% | NA |
VI/Aromatic | 96 | 43.80% | 0.00% | 23.96% | 32.29% | NA |
Intermediate | 90 | 56.70% | 0.00% | 17.78% | 25.56% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1122183927 | C -> T | LOC_Os11g37570.1 | upstream_gene_variant ; 2371.0bp to feature; MODIFIER | silent_mutation | Average:14.294; most accessible tissue: Callus, score: 33.479 | N | N | N | N |
vg1122183927 | C -> T | LOC_Os11g37580.1 | downstream_gene_variant ; 2537.0bp to feature; MODIFIER | silent_mutation | Average:14.294; most accessible tissue: Callus, score: 33.479 | N | N | N | N |
vg1122183927 | C -> T | LOC_Os11g37570-LOC_Os11g37580 | intergenic_region ; MODIFIER | silent_mutation | Average:14.294; most accessible tissue: Callus, score: 33.479 | N | N | N | N |
vg1122183927 | C -> DEL | N | N | silent_mutation | Average:14.294; most accessible tissue: Callus, score: 33.479 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1122183927 | 9.72E-06 | NA | mr1489_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |