\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122071248:

Variant ID: vg1122071248 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22071248
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


AAACATGTTAACACGGCATTAAAAACGGATGAAATGCGAAAGGGCATGTAACCTAGTGGTTACAAGAGCCTCTTTCAGTGGTAGCCTGTGGTGACTTCGT[C/T]
AATCTCTCCAGGATTTGTCGGCCCAGTCTTCGAAGATGCTCATAAGGGTAGGGGTTCGCGTGCATGTGTTCATAGGGGTGAGTGCGTTGTGAGTGTCTGT

Reverse complement sequence

ACAGACACTCACAACGCACTCACCCCTATGAACACATGCACGCGAACCCCTACCCTTATGAGCATCTTCGAAGACTGGGCCGACAAATCCTGGAGAGATT[G/A]
ACGAAGTCACCACAGGCTACCACTGAAAGAGGCTCTTGTAACCACTAGGTTACATGCCCTTTCGCATTTCATCCGTTTTTAATGCCGTGTTAACATGTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.60% 10.20% 0.40% 4.74% NA
All Indica  2759 79.00% 16.80% 0.47% 3.73% NA
All Japonica  1512 96.60% 0.90% 0.07% 2.38% NA
Aus  269 74.70% 0.40% 1.49% 23.42% NA
Indica I  595 80.70% 18.70% 0.50% 0.17% NA
Indica II  465 69.00% 30.10% 0.43% 0.43% NA
Indica III  913 83.10% 9.10% 0.88% 6.90% NA
Indica Intermediate  786 78.80% 16.50% 0.00% 4.71% NA
Temperate Japonica  767 99.00% 0.70% 0.00% 0.39% NA
Tropical Japonica  504 93.70% 1.00% 0.20% 5.16% NA
Japonica Intermediate  241 95.40% 1.70% 0.00% 2.90% NA
VI/Aromatic  96 81.20% 0.00% 1.04% 17.71% NA
Intermediate  90 88.90% 5.60% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122071248 C -> T LOC_Os11g37390.1 downstream_gene_variant ; 839.0bp to feature; MODIFIER silent_mutation Average:51.672; most accessible tissue: Callus, score: 79.366 N N N N
vg1122071248 C -> T LOC_Os11g37390-LOC_Os11g37400 intergenic_region ; MODIFIER silent_mutation Average:51.672; most accessible tissue: Callus, score: 79.366 N N N N
vg1122071248 C -> DEL N N silent_mutation Average:51.672; most accessible tissue: Callus, score: 79.366 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122071248 NA 9.48E-06 mr1011_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122071248 NA 2.01E-06 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122071248 NA 2.19E-06 mr1156_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122071248 NA 3.08E-10 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122071248 NA 3.96E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122071248 NA 3.79E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122071248 NA 5.07E-06 mr1636_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122071248 NA 1.43E-07 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122071248 NA 7.33E-06 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122071248 NA 1.33E-06 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122071248 NA 7.40E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122071248 NA 8.13E-07 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122071248 2.16E-06 2.15E-06 mr1983_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251