Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122053907:

Variant ID: vg1122053907 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22053907
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAGCACAGATGACGTACAAAAACCGGACGAATTACCCCTGACTCAATTTAGAGTGGTTTTCATCCTACGTGTACACGTGGTAGTTCGGAACGGTTTTGT[T/C]
CTACATGGTATACATTTGGCGCTAACGTGGCAATCCAATCTCCAAAAAAAACATAAAAAAATTAACAGGGCCCCACATGTCATATAGAGTAGTACTAAAC

Reverse complement sequence

GTTTAGTACTACTCTATATGACATGTGGGGCCCTGTTAATTTTTTTATGTTTTTTTTGGAGATTGGATTGCCACGTTAGCGCCAAATGTATACCATGTAG[A/G]
ACAAAACCGTTCCGAACTACCACGTGTACACGTAGGATGAAAACCACTCTAAATTGAGTCAGGGGTAATTCGTCCGGTTTTTGTACGTCATCTGTGCTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.20%	14.50%	0.34%	4.97%	NA
All Indica	2759	95.10%	0.50%	0.54%	3.84%	NA
All Japonica	1512	54.30%	43.20%	0.07%	2.45%	NA
Aus	269	72.90%	1.50%	0.00%	25.65%	NA
Indica I	595	99.00%	0.70%	0.17%	0.17%	NA
Indica II	465	99.40%	0.20%	0.00%	0.43%	NA
Indica III	913	92.00%	0.50%	0.22%	7.23%	NA
Indica Intermediate	786	93.10%	0.60%	1.53%	4.71%	NA
Temperate Japonica	767	33.10%	66.40%	0.13%	0.39%	NA
Tropical Japonica	504	81.90%	12.70%	0.00%	5.36%	NA
Japonica Intermediate	241	63.90%	33.20%	0.00%	2.90%	NA
VI/Aromatic	96	78.10%	3.10%	0.00%	18.75%	NA
Intermediate	90	84.40%	10.00%	0.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122053907	T -> DEL	N	N	silent_mutation	Average:68.01; most accessible tissue: Minghui63 young leaf, score: 79.896	N	N	N	N
vg1122053907	T -> C	LOC_Os11g37350.1	upstream_gene_variant ; 3907.0bp to feature; MODIFIER	silent_mutation	Average:68.01; most accessible tissue: Minghui63 young leaf, score: 79.896	N	N	N	N
vg1122053907	T -> C	LOC_Os11g37370.1	upstream_gene_variant ; 1158.0bp to feature; MODIFIER	silent_mutation	Average:68.01; most accessible tissue: Minghui63 young leaf, score: 79.896	N	N	N	N
vg1122053907	T -> C	LOC_Os11g37360.1	downstream_gene_variant ; 710.0bp to feature; MODIFIER	silent_mutation	Average:68.01; most accessible tissue: Minghui63 young leaf, score: 79.896	N	N	N	N
vg1122053907	T -> C	LOC_Os11g37360-LOC_Os11g37370	intergenic_region ; MODIFIER	silent_mutation	Average:68.01; most accessible tissue: Minghui63 young leaf, score: 79.896	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122053907	NA	1.97E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	3.60E-09	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	3.06E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	6.23E-13	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	4.54E-06	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	1.39E-29	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	1.48E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	5.16E-08	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	6.85E-07	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	3.31E-06	mr1338	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	5.20E-06	mr1380	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	9.93E-06	mr1397	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	3.79E-06	mr1502	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	4.51E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	4.46E-07	1.16E-10	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	3.16E-13	mr1539	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	9.63E-06	NA	mr1540	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	3.53E-06	mr1555	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	4.44E-06	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	1.89E-07	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	4.76E-06	7.41E-21	mr1679	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	8.22E-09	mr1679	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	5.72E-06	mr1686	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	7.25E-09	mr1691	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	6.28E-06	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	1.44E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	3.83E-06	1.21E-12	mr1732	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	8.54E-06	mr1736	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	2.54E-07	mr1740	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	1.43E-12	mr1741	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	1.10E-06	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	1.87E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	1.49E-17	mr1539_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	5.34E-17	mr1540_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	5.00E-09	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	5.40E-16	mr1732_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	3.36E-07	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907	NA	9.01E-06	mr1996_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251