\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122053907:

Variant ID: vg1122053907 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22053907
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAGCACAGATGACGTACAAAAACCGGACGAATTACCCCTGACTCAATTTAGAGTGGTTTTCATCCTACGTGTACACGTGGTAGTTCGGAACGGTTTTGT[T/C]
CTACATGGTATACATTTGGCGCTAACGTGGCAATCCAATCTCCAAAAAAAACATAAAAAAATTAACAGGGCCCCACATGTCATATAGAGTAGTACTAAAC

Reverse complement sequence

GTTTAGTACTACTCTATATGACATGTGGGGCCCTGTTAATTTTTTTATGTTTTTTTTGGAGATTGGATTGCCACGTTAGCGCCAAATGTATACCATGTAG[A/G]
ACAAAACCGTTCCGAACTACCACGTGTACACGTAGGATGAAAACCACTCTAAATTGAGTCAGGGGTAATTCGTCCGGTTTTTGTACGTCATCTGTGCTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.20% 14.50% 0.34% 4.97% NA
All Indica  2759 95.10% 0.50% 0.54% 3.84% NA
All Japonica  1512 54.30% 43.20% 0.07% 2.45% NA
Aus  269 72.90% 1.50% 0.00% 25.65% NA
Indica I  595 99.00% 0.70% 0.17% 0.17% NA
Indica II  465 99.40% 0.20% 0.00% 0.43% NA
Indica III  913 92.00% 0.50% 0.22% 7.23% NA
Indica Intermediate  786 93.10% 0.60% 1.53% 4.71% NA
Temperate Japonica  767 33.10% 66.40% 0.13% 0.39% NA
Tropical Japonica  504 81.90% 12.70% 0.00% 5.36% NA
Japonica Intermediate  241 63.90% 33.20% 0.00% 2.90% NA
VI/Aromatic  96 78.10% 3.10% 0.00% 18.75% NA
Intermediate  90 84.40% 10.00% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122053907 T -> DEL N N silent_mutation Average:68.01; most accessible tissue: Minghui63 young leaf, score: 79.896 N N N N
vg1122053907 T -> C LOC_Os11g37350.1 upstream_gene_variant ; 3907.0bp to feature; MODIFIER silent_mutation Average:68.01; most accessible tissue: Minghui63 young leaf, score: 79.896 N N N N
vg1122053907 T -> C LOC_Os11g37370.1 upstream_gene_variant ; 1158.0bp to feature; MODIFIER silent_mutation Average:68.01; most accessible tissue: Minghui63 young leaf, score: 79.896 N N N N
vg1122053907 T -> C LOC_Os11g37360.1 downstream_gene_variant ; 710.0bp to feature; MODIFIER silent_mutation Average:68.01; most accessible tissue: Minghui63 young leaf, score: 79.896 N N N N
vg1122053907 T -> C LOC_Os11g37360-LOC_Os11g37370 intergenic_region ; MODIFIER silent_mutation Average:68.01; most accessible tissue: Minghui63 young leaf, score: 79.896 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122053907 NA 1.97E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 3.60E-09 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 3.06E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 6.23E-13 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 4.54E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 1.39E-29 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 1.48E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 5.16E-08 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 6.85E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 3.31E-06 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 5.20E-06 mr1380 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 9.93E-06 mr1397 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 3.79E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 4.51E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 4.46E-07 1.16E-10 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 3.16E-13 mr1539 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 9.63E-06 NA mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 3.53E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 4.44E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 1.89E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 4.76E-06 7.41E-21 mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 8.22E-09 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 5.72E-06 mr1686 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 7.25E-09 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 6.28E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 1.44E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 3.83E-06 1.21E-12 mr1732 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 8.54E-06 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 2.54E-07 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 1.43E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 1.10E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 1.87E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 1.49E-17 mr1539_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 5.34E-17 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 5.00E-09 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 5.40E-16 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 3.36E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122053907 NA 9.01E-06 mr1996_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251