\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122020161:

Variant ID: vg1122020161 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22020161
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, C: 0.08, others allele: 0.00, population size: 38. )

Flanking Sequence (100 bp) in Reference Genome:


TTATGGTGCTATATTTTTTATAAAAAAATAGTCGGCATGTATTTACATTGTAAGTCCCTAAATTACATATGTAATTTTAGTGTATTTACAATGTAAGTCT[T/C]
AAAATTACATATGTAATGTAAATTTGAAAATTACATACTAATTACATATATAAGTGAGGTGTAAATGAGGTGTAACTACTGCGTAAGTGGCTGAAAAAAA

Reverse complement sequence

TTTTTTTCAGCCACTTACGCAGTAGTTACACCTCATTTACACCTCACTTATATATGTAATTAGTATGTAATTTTCAAATTTACATTACATATGTAATTTT[A/G]
AGACTTACATTGTAAATACACTAAAATTACATATGTAATTTAGGGACTTACAATGTAAATACATGCCGACTATTTTTTTATAAAAAATATAGCACCATAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.00% 18.50% 10.20% 44.24% NA
All Indica  2759 27.80% 1.30% 8.08% 62.85% NA
All Japonica  1512 22.30% 54.40% 14.02% 9.33% NA
Aus  269 54.30% 1.90% 11.15% 32.71% NA
Indica I  595 42.90% 1.50% 24.71% 30.92% NA
Indica II  465 28.40% 1.10% 2.15% 68.39% NA
Indica III  913 18.90% 0.80% 2.30% 77.98% NA
Indica Intermediate  786 26.20% 1.90% 5.73% 66.16% NA
Temperate Japonica  767 9.90% 74.10% 12.39% 3.65% NA
Tropical Japonica  504 42.10% 23.00% 17.46% 17.46% NA
Japonica Intermediate  241 20.30% 57.30% 12.03% 10.37% NA
VI/Aromatic  96 5.20% 0.00% 3.12% 91.67% NA
Intermediate  90 25.60% 14.40% 15.56% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122020161 T -> DEL N N silent_mutation Average:48.071; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg1122020161 T -> C LOC_Os11g37280.1 downstream_gene_variant ; 1622.0bp to feature; MODIFIER silent_mutation Average:48.071; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg1122020161 T -> C LOC_Os11g37290.1 intron_variant ; MODIFIER silent_mutation Average:48.071; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122020161 NA 3.24E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122020161 NA 3.53E-06 mr1380 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122020161 NA 1.61E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122020161 NA 4.55E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122020161 NA 8.77E-06 mr1826 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122020161 1.24E-06 2.44E-09 mr1982 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122020161 NA 7.28E-07 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122020161 NA 2.05E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251